CRCP (NM_001142414) Human Untagged Clone

CAT#: SC326714

CRCP (untagged)-Human CGRP receptor component (CRCP) transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CRCP
• Synonyms: CGRP-RCP; CGRPRCP; RCP; RCP9; RPC9
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001142414, the custom clone sequence may differ by one or more nucleotides
  ATGCAGCGCGGCGATCCCGGCGAGCACCTTGGCGCGCGGAGCTGGCACCTTGGCGCTGTT
  GGTGGCGGCGGAGACAGCTGTGAAGTGAAGGATGCCAATTCTGCGCTTCTCAGTAACTAC
  GAGACGTTAAAATACATATCAAAAACACCATGCAGGCACCAGAGTCCTGAAATTGTCAGA
  GAATTTCTCACAGCATTGAAAAGCCACAAGTTGACCAAAGCTGAGAAGCTCCAGCTGCTG
  AACCACCGGCCTGTGACTGCTGTGGAGATCCAGCTGATGGTGGAAGAGAGTGAAGAGCGG
  CTCACGGAGGAGCAGATTGAAGCTCTTCTCCACACCGTCACCAGCATTCTGCCTGCAGAG
  CCAGAGGCTGAGCAGAAGAAGAATACAAACAGCAATGTGGCAATGGACGAAGAGGACCCA
  GCA
  
• Restriction Sites: Please inquire
• ACCN: NM_001142414
• ORF Size: 426 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001142414.1, NP_001135886.1
• RefSeq Size: 2648
• RefSeq ORF: 426
• Locus ID: 27297
• Protein Families: Druggable Genome
• Gene Summary: This gene encodes a membrane protein that functions as part of a receptor complex for a small neuropeptide that increases intracellular cAMP levels. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (4) lacks an internal segment in the 5' region, which results in an upstream AUG start codon, and also lacks an exon in the middle region, as compared to variant 1. The reading frame is not affected, and the resulting isoform (d) is shorter and has a distinct N-terminus, as compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.