ZDHHC15 (NM_001146257) Human Untagged Clone
CAT#: SC326718
ZDHHC15 (untagged)-Human zinc finger DHHC-type containing 15 (ZDHHC15) transcript variant 3
"NM_001146257" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | ZDHHC15 |
Synonyms | DHHC15; MRX91 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_001146257, the custom clone sequence may differ by one or more nucleotides
ATGCGGCGAGGCTGGAAGATGGCTCTGTCTGGGGGGCTGCGGTGCTGCCGCCGGGTACTG TCCTGGGTGCCAGTGCTCGTTATTGTCCTCGTCGTGCTCTGGTCCTACTATGCCTACGTC TTTGAACTCTGCCTGGTTATTTACCTCATACTCTACCATGCCATCTTTGTGTTCTTTACC TGGACCTACTGGAAGTCTATCTTTACACTCCCACAGCAGCCAAACCAGAAGTTCCACTTG TCCTACACAGACAAGGAGCGCTATGAAAATGAAGAAAGACCTGAGGTCCAGAAGCAGATG CTTGTTGATATGGCCAAAAAGCTACCGGTTTACACAAGAACTGGAAGTGGAGGTCAGTTC ATCCAAAGGCAGCTAGAGAGGCAGCTCAGCAAGTATCTCAGAAAGGCTAAGTCATATATG TTCTCAAAC |
Restriction Sites | Please inquire |
ACCN | NM_001146257 |
ORF Size | 432 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001146257.1, NP_001139729.1 |
RefSeq Size | 1312 |
RefSeq ORF | 432 |
Locus ID | 158866 |
Protein Families | Transmembrane |
Gene Summary | The protein encoded by this gene belongs to the DHHC palmitoyltransferase family. Mutations in this gene are associated with mental retardatio X-linked type 91 (MRX91). Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009] Transcript Variant: This variant (3) is lacking an in-frame coding exon and differs at the 3' end compared to variant 1. This results in a shorter isoform (3) with a distinct C-terminus compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC228083 | ZDHHC15 (Myc-DDK-tagged)-Human zinc finger, DHHC-type containing 15 (ZDHHC15), transcript variant 3 |
USD 420.00 |
|
RG228083 | ZDHHC15 (GFP-tagged) - Human zinc finger, DHHC-type containing 15 (ZDHHC15), transcript variant 3 |
USD 460.00 |
|
RC228083L3 | Lenti-ORF clone of ZDHHC15 (Myc-DDK-tagged)-Human zinc finger, DHHC-type containing 15 (ZDHHC15), transcript variant 3 |
USD 620.00 |
|
RC228083L4 | Lenti-ORF clone of ZDHHC15 (mGFP-tagged)-Human zinc finger, DHHC-type containing 15 (ZDHHC15), transcript variant 3 |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review