NXNL2 (NM_001161625) Human Untagged Clone

CAT#: SC326726

NXNL2 (untagged)-Human nucleoredoxin-like 2 (NXNL2) transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: NXNL2
• Synonyms: C9orf121; RDCVF2; RdCVF2L
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001161625, the custom clone sequence may differ by one or more nucleotides
  ATGGTTGACATTCTGGGCGAGCGGCACCTGGTGACCTGTAAGGGCGCGACGGTGGAGGCC
  GAGGCGGCGCTGCAGAACAAGGTGGTGGCACTGTACTTCGCGGCGGCCCGGTGCGCGCCG
  AGCCGCGACTTCACGCCGCTGCTCTGCGACTTCTATACGGCGCTGGTGGCCGAGGCGCGG
  CGGCCCGCGCCCTTCGAAGTGGTCTTCGTGTCAGCCGACGGCAGCTCCCAGGAGATGCTG
  GACTTCATGCGCGAGCTGCATGGCGCCTGGCTGGCGCTGCCCTTCCACGACCCCTACCGG
  CATGAGCTGAGGAAGAGGTACAACGTCACAGCCATCCCCAAGCTTGTGATTGTGAAACAA
  AATGGGGAGGTCATCACCAACAAAGGGCGGAAGCAGATCCGGGAACGGGGGTTGGCCTGC
  TTCCAGGACTGGGTGGAGGCGGCCGATATCTTCCAGAATTTCTCCGTT
  
• Restriction Sites: Please inquire
• ACCN: NM_001161625
• ORF Size: 471 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001161625.1, NP_001155097.1
• RefSeq Size: 805
• RefSeq ORF: 471
• Locus ID: 158046
• Gene Summary: May be involved in the maintenance of both the function and the viability of sensory neurons, including photoreceptors and olfactory neurons. [UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (1) encodes the longer isoform (1).