NXNL2 (NM_001161625) Human Untagged Clone

CAT#: SC326726

NXNL2 (untagged)-Human nucleoredoxin-like 2 (NXNL2) transcript variant 1


  "NM_001161625" in other vectors (4)

Reconstitution Protocol

USD 420.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "NXNL2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol NXNL2
Synonyms C9orf121; RDCVF2; RdCVF2L
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_001161625, the custom clone sequence may differ by one or more nucleotides
ATGGTTGACATTCTGGGCGAGCGGCACCTGGTGACCTGTAAGGGCGCGACGGTGGAGGCC
GAGGCGGCGCTGCAGAACAAGGTGGTGGCACTGTACTTCGCGGCGGCCCGGTGCGCGCCG
AGCCGCGACTTCACGCCGCTGCTCTGCGACTTCTATACGGCGCTGGTGGCCGAGGCGCGG
CGGCCCGCGCCCTTCGAAGTGGTCTTCGTGTCAGCCGACGGCAGCTCCCAGGAGATGCTG
GACTTCATGCGCGAGCTGCATGGCGCCTGGCTGGCGCTGCCCTTCCACGACCCCTACCGG
CATGAGCTGAGGAAGAGGTACAACGTCACAGCCATCCCCAAGCTTGTGATTGTGAAACAA
AATGGGGAGGTCATCACCAACAAAGGGCGGAAGCAGATCCGGGAACGGGGGTTGGCCTGC
TTCCAGGACTGGGTGGAGGCGGCCGATATCTTCCAGAATTTCTCCGTT
Restriction Sites Please inquire     
ACCN NM_001161625
ORF Size 471 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001161625.1, NP_001155097.1
RefSeq Size 805
RefSeq ORF 471
Locus ID 158046
Gene Summary May be involved in the maintenance of both the function and the viability of sensory neurons, including photoreceptors and olfactory neurons. [UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) encodes the longer isoform (1).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.