SCOC (NM_001153484) Human Untagged Clone
CAT#: SC326728
SCOC (untagged)-Human short coiled-coil protein (SCOC) transcript variant 1
"NM_001153484" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | SCOC |
Synonyms | HRIHFB2072; SCOCO; UNC-69 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF sequence for NM_001153484 edited
ATGCGCAGGCGTGTATTCTCGAGTCAGGATTGGCGGGCGAGCGGCTGGGACGGGATGGGA TTCTTCTCACGGCGCACGTTCTGTGGGCGGAGTGGGCGGAGCTGCCGGGGTCAGTTGGTC CAAGTGTCCCGGCCTGAGGTGTCGGCCGGATCCCTCCTTCTCCCGGCGCCTCAAGCGGAA GACCATTCCTCAAGAATTTTGTATCCAAGGCCCAAAAGTTTGTTACCCAAGATGATGAAT GCTGACATGGATGCAGTTGATGCTGAAAATCAAGTGGAACTGGAGGAAAAAACAAGACTT ATTAATCAAGTGTTGGAACTCCAACACACACTTGAAGATCTCTCTGCAAGAGTAGATGCA GTTAAGGAAGAAAATCTGAAGCTAAAATCAGAAAACCAAGTTCTTGGACAATATATAGAA AATCTCATGTCAGCTTCTAGTGTTTTTCAAACAACTGACACAAAAAGCAAAAGAAAGTAA |
Restriction Sites | Please inquire |
ACCN | NM_001153484 |
ORF Size | 480 bp |
Insert Size | 800 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001153484.1. |
Reference Data | |
RefSeq | NM_001153484.1, NP_001146956.1 |
RefSeq Size | 1969 |
RefSeq ORF | 480 |
Locus ID | 60592 |
Gene Summary | This gene encodes a short coiled-coiled domain-containing protein that localizes to the Golgi apparatus. The encoded protein interacts with ADP-ribosylation factor-like proteins. Pseudogenes of this gene are found on chromosomes 1 and 14. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2009] Transcript Variant: This variant (1) encodes the longest isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC228093 | SCOC (Myc-DDK-tagged)-Human short coiled-coil protein (SCOC), transcript variant 1 |
USD 420.00 |
|
RG228093 | SCOC (GFP-tagged) - Human short coiled-coil protein (SCOC), transcript variant 1 |
USD 460.00 |
|
RC228093L3 | Lenti-ORF clone of SCOC (Myc-DDK-tagged)-Human short coiled-coil protein (SCOC), transcript variant 1 |
USD 620.00 |
|
RC228093L4 | Lenti-ORF clone of SCOC (mGFP-tagged)-Human short coiled-coil protein (SCOC), transcript variant 1 |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review