SCOC (NM_001153484) Human Untagged Clone

CAT#: SC326728

SCOC (untagged)-Human short coiled-coil protein (SCOC) transcript variant 1


  "NM_001153484" in other vectors (4)

Reconstitution Protocol

USD 420.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "SCOC"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol SCOC
Synonyms HRIHFB2072; SCOCO; UNC-69
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_001153484 edited
ATGCGCAGGCGTGTATTCTCGAGTCAGGATTGGCGGGCGAGCGGCTGGGACGGGATGGGA
TTCTTCTCACGGCGCACGTTCTGTGGGCGGAGTGGGCGGAGCTGCCGGGGTCAGTTGGTC
CAAGTGTCCCGGCCTGAGGTGTCGGCCGGATCCCTCCTTCTCCCGGCGCCTCAAGCGGAA
GACCATTCCTCAAGAATTTTGTATCCAAGGCCCAAAAGTTTGTTACCCAAGATGATGAAT
GCTGACATGGATGCAGTTGATGCTGAAAATCAAGTGGAACTGGAGGAAAAAACAAGACTT
ATTAATCAAGTGTTGGAACTCCAACACACACTTGAAGATCTCTCTGCAAGAGTAGATGCA
GTTAAGGAAGAAAATCTGAAGCTAAAATCAGAAAACCAAGTTCTTGGACAATATATAGAA
AATCTCATGTCAGCTTCTAGTGTTTTTCAAACAACTGACACAAAAAGCAAAAGAAAGTAA
Restriction Sites Please inquire     
ACCN NM_001153484
ORF Size 480 bp
Insert Size 800
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001153484.1.
Reference Data
RefSeq NM_001153484.1, NP_001146956.1
RefSeq Size 1969
RefSeq ORF 480
Locus ID 60592
Gene Summary This gene encodes a short coiled-coiled domain-containing protein that localizes to the Golgi apparatus. The encoded protein interacts with ADP-ribosylation factor-like proteins. Pseudogenes of this gene are found on chromosomes 1 and 14. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2009]
Transcript Variant: This variant (1) encodes the longest isoform (1).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.