EMX2 (NM_001165924) Human Untagged Clone
CAT#: SC326740
EMX2 (untagged)-Human empty spiracles homeobox 2 (EMX2) transcript variant 2
"NM_001165924" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | EMX2 |
Synonyms | empty spiracles homeobox 2; empty spiracles homolog 2; OTTHUMP00000020578 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001165924, the custom clone sequence may differ by one or more nucleotides
ATGTTCCAGCCGGCGCCCAAGCGCTGCTTCACCATCGAGTCGCTGGTGGCCAAGGACAGT CCCCTGCCCGCCTCGCGCTCCGAGGACCCCATCCGTCCCGCGGCACTCAGCTACGCTAAC TCCAGCCCCATAAATCCGTTCCTCAACGGCTTCCACTCGGCCGCCGCCGCCGCCGCCGGT AGGGGCGTCTACTCCAACCCGGACTTGGTGTTCGCCGAGGCGGTCTCGCACCCGCCCAAC CCCGCCGTGCCAGTGCACCCGGTGCCGCCGCCGCACGCCCTGGCCGCCCACCCCCTACCC TCCTCGCACTCGCCACACCCCCTATTCGCCTCGCAGCAGCGGGATCCGTCCACCTTCTAC CCCTGGCTCATCCACCGCTACCGATATCTGGGTCATCGCTTCCAAGGTAAAAGTATGGTT TCAGAACCGAAGAACAAAGTTCAAAAGGCAGAAGCTGGAGGAAGAAGGCTCAGATTCGCA ACAAAAGAAAAAAGGGACGCACCATAT |
Restriction Sites | Please inquire |
ACCN | NM_001165924 |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001165924.1, NP_001159396.1 |
RefSeq Size | 2723 bp |
RefSeq ORF | 510 bp |
Locus ID | 2018 |
Cytogenetics | 10q26.11 |
Protein Families | Druggable Genome |
Gene Summary | 'This gene encodes a homeobox-containing transcription factor that is the homolog to the 'empty spiracles' gene in Drosophila. Research on this gene in humans has focused on its expression in three tissues: dorsal telencephalon, olfactory neuroepithelium, and urogenetial system. It is expressed in the dorsal telencephalon during development in a low rostral-lateral to high caudal-medial gradient and is proposed to pattern the neocortex into defined functional areas. It is also expressed in embryonic and adult olfactory neuroepithelia where it complexes with eukaryotic translation initiation factor 4E (eIF4E) and possibly regulates mRNA transport or translation. In the developing urogenital system, it is expressed in epithelial tissues and is negatively regulated by HOXA10. Alternative splicing results in multiple transcript variants encoding distinct proteins.[provided by RefSeq, Sep 2009]' Transcript Variant: This variant (2) lacks an exon in the coding region, compared to variant 1, which results in a frameshift and a protein (isoform 2) with a shorter and distinct C-terminus, compared to isoform 1. Isoform 2 lacks the C-terminal homeodomain of isoform 1. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC228105 | EMX2 (Myc-DDK-tagged)-Human empty spiracles homeobox 2 (EMX2), transcript variant 2 |
USD 420.00 |
|
RG228105 | EMX2 (GFP-tagged) - Human empty spiracles homeobox 2 (EMX2), transcript variant 2 |
USD 460.00 |
|
RC228105L1 | Lenti ORF clone of Human empty spiracles homeobox 2 (EMX2), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
RC228105L2 | Lenti ORF clone of Human empty spiracles homeobox 2 (EMX2), transcript variant 2, mGFP tagged |
USD 620.00 |
|
RC228105L3 | Lenti ORF clone of Human empty spiracles homeobox 2 (EMX2), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
RC228105L4 | Lenti ORF clone of Human empty spiracles homeobox 2 (EMX2), transcript variant 2, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review