RPAIN (NM_001160244) Human Untagged Clone

CAT#: SC326744

RPAIN (untagged)-Human RPA interacting protein (RPAIN) transcript variant 3


  "NM_001160244" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "RPAIN"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol RPAIN
Synonyms HRIP; RIP
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_001160244, the custom clone sequence may differ by one or more nucleotides
ATGGCGGAGTCGTTGAGGTCTCCGCGCCGCTCCCTGTACAAACTGGTGGGCTCGCCGCCT
TGGAAAGAGGCTTTCCGGCAGAGATGCCTGGAGAGAATGAGAAACAGCCGGGACAGGCTC
CTAAACAGGTACCGCCAGGCTGGAAGCAGTGGGCCAGGGAATTCTCAGAACAGCTTTCTA
GTTCAAGAGGTGATGGAAGAAGAGTGGAATGCTTTGCAGTCAGTGGAGAATTGTCCAGAA
GACTTGGCTCAGCTGGAGGAGCTGATAGACATGGCTGTGCTGGAGGAAATTCAACAGGAG
CTGATCAACCAAGAGCAGTCCATCATCAGCGAGTATGAGAAGAGCTTGCAGTTTGATGAA
AAGTGTCTCAGCATCATGCTGGCTGAGTGGGAGGCAAACCCACTCATCTGTCCTGTATGT
ACAAAGTACAACCTGAGAATCACAAGCGGTGTGGTGGTGTGTCAGTGTGGCCTGTCCATC
CCATCTCATGCCTGTGATACTTGGGCTGTGATCCTC
Restriction Sites Please inquire     
ACCN NM_001160244
ORF Size 519 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001160244.1, NP_001153716.1
RefSeq Size 1538
RefSeq ORF 519
Locus ID 84268
Gene Summary Mediates the import of RPA complex into the nucleus, possibly via some interaction with importin beta. Isoform 2 is sumoylated and mediates the localization of RPA complex into the PML body of the nucleus, thereby participating in RPA function in DNA metabolism. [UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) differs in the 3' coding region and 3' UTR, compared to variant 1. It encodes isoform c, which has a shorter and distinct C-terminus compared to isoform a.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.