KCNMB3 (NM_001163677) Human Untagged Clone

CAT#: SC326745

KCNMB3 (untagged)-Human potassium large conductance calcium-activated channel subfamily M beta member 3 (KCNMB3) transcript variant 5


  "NM_001163677" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "KCNMB3"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol KCNMB3
Synonyms BKBETA3; HBETA3; K(VCA)BETA-3; KCNMB2; KCNMBL; SLO-BETA-3; SLOBETA3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001163677, the custom clone sequence may differ by one or more nucleotides


ATGCAGCCCTTCAGCATCCCCGTGCAAATCACACTTCAGGGCAGCCGGAGGCGCCAGGGGAGGACAGCCT
TTCCTGCCTCAGGGAAGAAGAGAGAGACAGACTACAGTGATGGAGACCCACTAGATGTGCACAAGAGGCT
GCCATCCAGTGCTGGAGAGGACCGAGCCGTGATGCTGGGGTTTGCCATGATGGGCTTCTCAGTCCTAATG
TTCTTCTTGCTCGGAACAACCATTCTAAAGCCTTTTATGCTCAGCATTCAGAGAGAAGAATCGACCTGCA
CTGCCATCCACACAGATATCATGGACGACTGGCTGGACTGTGCCTTCACCTGTGGTGTGCACTGCCACGG
TCAGGGGAAGTACCCGTGTCTTCAGGTGTTTGTGAACCTCAGCCATCCAGGTCAGAAAGCTCTCCTACAT
TATAATGAAGAGGCTGTCCAGATAAATCCCAAGCGTGATGTTACAGACTGCAGAGTTAAAGAAAAGCAGA
CATTGACAGTTTCTGATGAGCATAAACAGTAA


Restriction Sites SgfI-MluI     
ACCN NM_001163677
ORF Size 522 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001163677.1, NP_001157149.1
RefSeq Size 1123
RefSeq ORF 522
Locus ID 27094
Protein Families Druggable Genome, Ion Channels: Other, Transmembrane
Protein Pathways Vascular smooth muscle contraction
Gene Summary MaxiK channels are large conductance, voltage and calcium-sensitive potassium channels which are fundamental to the control of smooth muscle tone and neuronal excitability. MaxiK channels can be formed by 2 subunits: the pore-forming alpha subunit and the modulatory beta subunit. The protein encoded by this gene is an auxiliary beta subunit which may partially inactivate or slightly decrease the activation time of MaxiK alpha subunit currents. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 22. [provided by RefSeq, Jul 2009]
Transcript Variant: This variant (5) differs in both UTRs and in both the 5' and 3' coding regions, and uses an alternate translational start codon, compared to variant 4. The resulting isoform (e) has distinct N- and C-termini and is shorter than isoform d.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.