KCNMB3 (NM_001163677) Human Untagged Clone
CAT#: SC326745
KCNMB3 (untagged)-Human potassium large conductance calcium-activated channel subfamily M beta member 3 (KCNMB3) transcript variant 5
"NM_001163677" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | KCNMB3 |
Synonyms | BKBETA3; HBETA3; K(VCA)BETA-3; KCNMB2; KCNMBL; SLO-BETA-3; SLOBETA3 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001163677, the custom clone sequence may differ by one or more nucleotides
ATGCAGCCCTTCAGCATCCCCGTGCAAATCACACTTCAGGGCAGCCGGAGGCGCCAGGGGAGGACAGCCT TTCCTGCCTCAGGGAAGAAGAGAGAGACAGACTACAGTGATGGAGACCCACTAGATGTGCACAAGAGGCT GCCATCCAGTGCTGGAGAGGACCGAGCCGTGATGCTGGGGTTTGCCATGATGGGCTTCTCAGTCCTAATG TTCTTCTTGCTCGGAACAACCATTCTAAAGCCTTTTATGCTCAGCATTCAGAGAGAAGAATCGACCTGCA CTGCCATCCACACAGATATCATGGACGACTGGCTGGACTGTGCCTTCACCTGTGGTGTGCACTGCCACGG TCAGGGGAAGTACCCGTGTCTTCAGGTGTTTGTGAACCTCAGCCATCCAGGTCAGAAAGCTCTCCTACAT TATAATGAAGAGGCTGTCCAGATAAATCCCAAGCGTGATGTTACAGACTGCAGAGTTAAAGAAAAGCAGA CATTGACAGTTTCTGATGAGCATAAACAGTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001163677 |
ORF Size | 522 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001163677.1, NP_001157149.1 |
RefSeq Size | 1123 |
RefSeq ORF | 522 |
Locus ID | 27094 |
Protein Families | Druggable Genome, Ion Channels: Other, Transmembrane |
Protein Pathways | Vascular smooth muscle contraction |
Gene Summary | MaxiK channels are large conductance, voltage and calcium-sensitive potassium channels which are fundamental to the control of smooth muscle tone and neuronal excitability. MaxiK channels can be formed by 2 subunits: the pore-forming alpha subunit and the modulatory beta subunit. The protein encoded by this gene is an auxiliary beta subunit which may partially inactivate or slightly decrease the activation time of MaxiK alpha subunit currents. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 22. [provided by RefSeq, Jul 2009] Transcript Variant: This variant (5) differs in both UTRs and in both the 5' and 3' coding regions, and uses an alternate translational start codon, compared to variant 4. The resulting isoform (e) has distinct N- and C-termini and is shorter than isoform d. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC228110 | KCNMB3 (Myc-DDK-tagged)-Human potassium large conductance calcium-activated channel, subfamily M beta member 3 (KCNMB3), transcript variant 5 |
USD 420.00 |
|
RG228110 | KCNMB3 (GFP-tagged) - Human potassium large conductance calcium-activated channel, subfamily M beta member 3 (KCNMB3), transcript variant 5 |
USD 460.00 |
|
RC228110L3 | Lenti ORF clone of Human potassium large conductance calcium-activated channel, subfamily M beta member 3 (KCNMB3), transcript variant 5, Myc-DDK-tagged |
USD 620.00 |
|
RC228110L4 | Lenti ORF clone of Human potassium large conductance calcium-activated channel, subfamily M beta member 3 (KCNMB3), transcript variant 5, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review