ZNF268 (NM_001165884) Human Untagged Clone
CAT#: SC326751
ZNF268 (untagged)-Human zinc finger protein 268 (ZNF268) transcript variant 6
"NM_001165884" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | ZNF268 |
Synonyms | HZF3 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_001165884, the custom clone sequence may differ by one or more nucleotides
ATGGCCACCAGGGTCCGGACAGCTTCTATTTGGGTCCCACCTCTCCAAGAACGAAACAGT TCATGGGATAGGATCAGAAAGCTCCAAGGTCAGGAATCCATCTTGGGCCAAGGGACTCCT GGTCTGCAACCTCTCCCTGGAACACCCAGGCAGAAGCAGAAGAGTCGCAGAATAGAGAAA GTCCTAGAGTGGCTGTTTATTTCCCAAGAGCAGCCAAAAATCACCAAGTCCTGGGAGTGG CAGCTGCTAGACCCAGCACAGAAGTGCCTGTACAGGAGTGTGATGTTGGAGAACTATAGC AACCTGGTGTCCCTAGGGTACCAACACACCAAACCTGATATCATCTTCAAGTTGGAACAA GGAGAAGAGCTGTGTATGGTGCAGGCCCAAGTTCCAAATCAGACCTGTCCAATTTTGAAG GCTGGAAAGTCCAAAGCCAAGGTGCTGGCAGGTTTGGTGTCTGGTGAGGGCCTGCTCTGT GCTTCCAAGATGACGCCTTGTTGCTGCATCCTCTGGAGACACAGTCTGGAAAAT |
Restriction Sites | Please inquire |
ACCN | NM_001165884 |
ORF Size | 537 bp |
Insert Size | 5332 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001165884.1, NP_001159356.1 |
RefSeq Size | 5332 |
RefSeq ORF | 537 |
Locus ID | 10795 |
Protein Families | Transcription Factors |
Gene Summary | Isoform 2: Contributes to cervical carcinogenesis in part through the TNF-alpha-induced NF-kappa-B signaling pathway by interacting with the I-kappa-B-kinase (IKK) core complex. [UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (6) lacks three alternate exons in the coding region, which causes a frameshift compared to variant 1. The resulting isoform (e) is shorter and has a distinct C-terminus compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC228116 | ZNF268 (Myc-DDK-tagged)-Human zinc finger protein 268 (ZNF268), transcript variant 6 |
USD 420.00 |
|
RG228116 | ZNF268 (GFP-tagged) - Human zinc finger protein 268 (ZNF268), transcript variant 6 |
USD 460.00 |
|
RC228116L3 | Lenti-ORF clone of ZNF268 (Myc-DDK-tagged)-Human zinc finger protein 268 (ZNF268), transcript variant 6 |
USD 620.00 |
|
RC228116L4 | Lenti-ORF clone of ZNF268 (mGFP-tagged)-Human zinc finger protein 268 (ZNF268), transcript variant 6 |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review