ZNF268 (NM_001165884) Human Untagged Clone

CAT#: SC326751

ZNF268 (untagged)-Human zinc finger protein 268 (ZNF268) transcript variant 6


  "NM_001165884" in other vectors (4)

Reconstitution Protocol

USD 420.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "ZNF268"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ZNF268
Synonyms HZF3
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_001165884, the custom clone sequence may differ by one or more nucleotides
ATGGCCACCAGGGTCCGGACAGCTTCTATTTGGGTCCCACCTCTCCAAGAACGAAACAGT
TCATGGGATAGGATCAGAAAGCTCCAAGGTCAGGAATCCATCTTGGGCCAAGGGACTCCT
GGTCTGCAACCTCTCCCTGGAACACCCAGGCAGAAGCAGAAGAGTCGCAGAATAGAGAAA
GTCCTAGAGTGGCTGTTTATTTCCCAAGAGCAGCCAAAAATCACCAAGTCCTGGGAGTGG
CAGCTGCTAGACCCAGCACAGAAGTGCCTGTACAGGAGTGTGATGTTGGAGAACTATAGC
AACCTGGTGTCCCTAGGGTACCAACACACCAAACCTGATATCATCTTCAAGTTGGAACAA
GGAGAAGAGCTGTGTATGGTGCAGGCCCAAGTTCCAAATCAGACCTGTCCAATTTTGAAG
GCTGGAAAGTCCAAAGCCAAGGTGCTGGCAGGTTTGGTGTCTGGTGAGGGCCTGCTCTGT
GCTTCCAAGATGACGCCTTGTTGCTGCATCCTCTGGAGACACAGTCTGGAAAAT
Restriction Sites Please inquire     
ACCN NM_001165884
ORF Size 537 bp
Insert Size 5332
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001165884.1, NP_001159356.1
RefSeq Size 5332
RefSeq ORF 537
Locus ID 10795
Protein Families Transcription Factors
Gene Summary Isoform 2: Contributes to cervical carcinogenesis in part through the TNF-alpha-induced NF-kappa-B signaling pathway by interacting with the I-kappa-B-kinase (IKK) core complex. [UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (6) lacks three alternate exons in the coding region, which causes a frameshift compared to variant 1. The resulting isoform (e) is shorter and has a distinct C-terminus compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.