MNX1 (NM_001165255) Human Untagged Clone

CAT#: SC326758

MNX1 (untagged)-Human motor neuron and pancreas homeobox 1 (MNX1) transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: MNX1
• Synonyms: HB9; HLXB9; HOXHB9; SCRA1
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for NM_001165255 edited
  ATGGGGGGACTCTCAACAGTAGGTGCCTGCCCTGGAATCCTGGGCGCCCAACAAGCCCAG
  GCGCAGTCGAACCTCCTGGGGAAGTGCCGCCGGCCGCGCACCGCCTTCACCAGCCAGCAG
  CTGCTGGAGCTGGAGCACCAGTTCAAGCTCAACAAGTACCTGTCGCGGCCCAAGCGCTTC
  GAGGTGGCCACCTCGCTCATGCTCACCGAGACCCAGGTGAAGATTTGGTTCCAGAACCGG
  CGGATGAAATGGAAACGCAGCAAAAAGGCCAAAGAGCAGGCGGCGCAGGAAGCGGAGAAA
  CAGAAGGGCGGCGGCGGGGGCGCGGGGAAGGGCGGCGCGGAGGAGCCGGGAGCCGAGGAG
  CTGCTGGGGCCGCCAGCGCCCGGAGACAAGGGCAGCGGACGCCGCCTGCGGGACTTGAGG
  GACAGTGACCCCGAGGAGGACGAGGACGAGGACGACGAGGACCATTTCCCCTACAGCAAC
  GGCGCCAGCGTCCACGCCGCCTCCTCCGACTGCTCCTCGGAGGACGACTCGCCGCCCCCG
  CGGCCCAGCCACCAGCCCGCGCCCCAGTAG
  
• Restriction Sites: Please inquire
• ACCN: NM_001165255
• ORF Size: 570 bp
• Insert Size: 800
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001165255.1, NP_001158727.1
• RefSeq Size: 1620
• RefSeq ORF: 570
• Locus ID: 3110
• Protein Families: Druggable Genome, ES Cell Differentiation/IPS
• Protein Pathways: Maturity onset diabetes of the young
• Gene Summary: This gene encodes a nuclear protein, which contains a homeobox domain and is a transcription factor. Mutations in this gene result in Currarino syndrome, an autosomic dominant congenital malformation. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
  Transcript Variant: This variant (2) has an alternate 5' exon, as compared to variant 1. The resulting isoform (2) is shorter and has a distinct N-terminus, as compared to isoform 1.