RAB28 (NM_001159601) Human Untagged Clone

CAT#: SC326770

RAB28 (untagged)-Human RAB28 member RAS oncogene family (RAB28) transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: RAB28
• Synonyms: CORD18
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001159601, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTCGGACTCTGAGGAGGAGAGCCAGGACCGGCAACTGAAAATCGTCGTGCTGGGGGACGGCGCCTCCG
  GGAAGACCTCCTTAACTACGTGTTTTGCTCAAGAAACTTTTGGGAAACAGTACAAACAAACTATAGGACT
  GGATTTCTTTTTGAGAAGGATAACATTGCCAGGAAACTTGAATGTTACCCTTCAAATTTGGGATATAGGA
  GGGCAGACAATAGGAGGCAAAATGTTGGATAAATATATCTATGGAGCACAGGGAGTCCTCTTGGTATATG
  ATATTACAAATTATCAAAGCTTTGAGAATTTAGAAGATTGGTATACTGTGGTGAAGAAAGTGAGCGAGGA
  GTCAGAAACTCAGCCACTGGTTGCCTTGGTAGGCAATAAAATTGATTTGGAGCATATGCGAACAATAAAA
  CCTGAAAAACACTTACGGTTTTGCCAGGAAAATGGTTTTAGTAGCCACTTTGTCTCAGCCAAGACAGGAG
  ACTCTGTCTTCCTGTGCTTTCAGAAAGTTGCTGCTGAAATCCTTGGGATCAAATTAAACAAAGCAGAAAT
  AGAACAGTCACAGGGCCATTTCATTATTTTCATTTCATCAACTAATAGAGAATAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001159601
• ORF Size: 615 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001159601.1, NP_001153073.1
• RefSeq Size: 1805
• RefSeq ORF: 615
• Locus ID: 9364
• Protein Families: Druggable Genome
• Gene Summary: This gene encodes a member of the Rab subfamily of Ras-related small GTPases. The encoded protein may be involved in regulating intracellular trafficking. Alternative splicing results in multiple transcript variants. Pseudogenes of this gene are found on chromosomes 9 and X. [provided by RefSeq, Apr 2009]
  Transcript Variant: This variant (3) has an alternate exon in the 3' coding region, compared to variant 1, that causes a frameshift. The resulting isoform (3) is shorter and has a distinct C-terminus compared to isoform 1.