ETS1 (NM_001162422) Human Untagged Clone
CAT#: SC326792
ETS1 (untagged)-Human v-ets erythroblastosis virus E26 oncogene homolog 1 (avian) (ETS1) transcript variant 3
"NM_001162422" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | ETS1 |
Synonyms | c-ets-1; ETS-1; EWSR2; p54 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC326792 representing NM_001162422
Red=Cloning site Blue=ORF TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGAAGGCGGCCGTCGATCTCAAGCCGACTCTCACCATCATCAAGACGGAAAAAGTCGATCTGGAGCTTT TCCCCTCCCCGGGTAAACTCGGGGGCCAGGACTCTTTTGAAAGCATAGAGAGCTACGATAGTTGTGATCG CCTCACCCAGTCCTGGAGCAGCCAGTCATCTTTCAACAGCCTGCAGCGTGTTCCCTCCTATGACAGCTTC GACTCAGAGGACTATCCGGCTGCCCTGCCCAACCACAAGCCCAAGGGCACCTTCAAGGACTATGTGCGGG ACCGTGCTGACCTCAATAAGGACAAGCCTGTCATTCCTGCTGCTGCCCTAGCTGGCTACACAGGCAGTGG ACCAATCCAGCTGTGGCAGTTTCTTCTGGAATTACTCACTGATAAATCCTGTCAGTCTTTTATCAGCTGG ACAGGAGATGGCTGGGAATTCAAACTTTCTGACCCAGATGAGGTGGCCAGGAGATGGGGAAAGAGGAAAA ACAAACCTAAGATGAATTATGAGAAACTGAGCCGTGGCCTACGCTACTATTACGACAAAAACATCATCCA CAAGACAGCGGGGAAACGCTACGTGTACCGCTTTGTGTGTGACCTGCAGAGCCTGCTGGGGTACACCCCT GAGGAGCTGCACGCCATGCTGGACGTCAAGCCAGATGCCGACGAGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | Please inquire |
ACCN | NM_001162422 |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001162422.1, NP_001155894.1 |
RefSeq Size | 4594 bp |
RefSeq ORF | 678 bp |
Locus ID | 2113 |
Cytogenetics | 11q24.3 |
Protein Families | Druggable Genome, Transcription Factors |
Protein Pathways | Dorso-ventral axis formation, Pathways in cancer, Renal cell carcinoma |
Gene Summary | 'This gene encodes a member of the ETS family of transcription factors, which are defined by the presence of a conserved ETS DNA-binding domain that recognizes the core consensus DNA sequence GGAA/T in target genes. These proteins function either as transcriptional activators or repressors of numerous genes, and are involved in stem cell development, cell senescence and death, and tumorigenesis. Alternatively spliced transcript variants encoding different isoforms have been described for this gene.[provided by RefSeq, Jul 2011]' Transcript Variant: This variant (3) uses an alternate promoter, and differs in the 5' UTR and 5' coding region compared to variant 1. It is also missing four consecutive in-frame coding exons, resulting in a shorter isoform (3, also known as Ets-1 p27) with a distinct N-terminus and lacking an internal protein segment compared to isoform 1. This isoform has been shown to exert a dominant negative effect on the transcriptional properties and the subcellular localization of Ets-1 p51 isoform (PMID:19377509). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC228157 | ETS1 (Myc-DDK-tagged)-Human v-ets erythroblastosis virus E26 oncogene homolog 1 (avian) (ETS1), transcript variant 3 |
USD 420.00 |
|
RG228157 | ETS1 (GFP-tagged) - Human v-ets erythroblastosis virus E26 oncogene homolog 1 (avian) (ETS1), transcript variant 3 |
USD 460.00 |
|
RC228157L1 | Lenti ORF clone of Human v-ets erythroblastosis virus E26 oncogene homolog 1 (avian) (ETS1), transcript variant 3, Myc-DDK-tagged |
USD 768.00 |
|
RC228157L2 | Lenti ORF clone of Human v-ets erythroblastosis virus E26 oncogene homolog 1 (avian) (ETS1), transcript variant 3, mGFP tagged |
USD 620.00 |
|
RC228157L3 | Lenti ORF clone of Human v-ets erythroblastosis virus E26 oncogene homolog 1 (avian) (ETS1), transcript variant 3, Myc-DDK-tagged |
USD 620.00 |
|
RC228157L4 | Lenti ORF clone of Human v-ets erythroblastosis virus E26 oncogene homolog 1 (avian) (ETS1), transcript variant 3, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review