Z DNA binding protein (ZBP1) (NM_001160419) Human Untagged Clone
CAT#: SC326815
ZBP1 (untagged)-Human Z-DNA binding protein 1 (ZBP1) transcript variant 4
"NM_001160419" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | ZBP1 |
Synonyms | C20orf183; DAI; DLM-1; DLM1 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_001160419, the custom clone sequence may differ by one or more nucleotides
ATGGCCCAGGCTCCTGCTGACCCGGGCAGAGAAGGCCACCTTGAACAAAGAATCCTGCAG GTGCTGACAGAGGCTGGCTCCCCGGTGAAACTTGCCCAGCTGGTGAAGGAATGCCAAGCA CCCAAGAGGGAGCTCAACCAAGTCCTCTACCGAATGAAAAAGGAGTTGAAAGTCTCCCTC ACATCCCCTGCCACCTGGTGCTTGGGCGGGACTGATCCTGAAGGCGAGGGTCCTGCAGAG CTGGCCTTGTCCAGCCCTGCCGAGAGGCCCCAGCAACATGCAGCTACAATTCCAGAGACC CCTGGCCCTCAGTTCAGCCAACAACGGGAGGAAGACATCTACAGGTTTCTCAAAGACAAT GGTCCCCAGAGGGCCCTGGTCATCGCCCAAGCACTGGGAATGAGGACAGCAAAAGATGTG AACCGAGACTTGTACAGGATGAAGAGCAGGCACCTTCTGGACATGGATGAGCAGTCCAAA GCATGGACGATTTACCGCCCAGAAGATTCTGGAAGAAGAGCAAAGTCAGCCTCAATTATT TACCAGCACAATCCAATCAACATGATCTGCCAGAATGGACCCAACAGCTGGATTTCCATT GCAAACTCCGAAGCCATCCAGATTGGACACGGGAACATCATTACAAGACAGACAGTCTCC AGGGAGGACGGTAAGTCACCCAAGAGAGCCCAGGGAGGGGACCTCGGTGGGGAGCCACCG GATCCTCTGGGTGGGGGCAAAGGG |
Restriction Sites | Please inquire |
ACCN | NM_001160419 |
ORF Size | 747 bp |
Insert Size | 1255 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001160419.1, NP_001153891.1 |
RefSeq Size | 1255 |
RefSeq ORF | 747 |
Locus ID | 81030 |
Protein Pathways | Cytosolic DNA-sensing pathway |
Gene Summary | This gene encodes a Z-DNA binding protein. The encoded protein plays a role in the innate immune response by binding to foreign DNA and inducing type-I interferon production. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011] Transcript Variant: This variant (4) differs in the 3' coding region and 3' UTR, compared to variant 1. The encoded isoform (d) is shorter and has a distinct C-terminus compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC228180 | ZBP1 (Myc-DDK-tagged)-Human Z-DNA binding protein 1 (ZBP1), transcript variant 4 |
USD 420.00 |
|
RG228180 | ZBP1 (GFP-tagged) - Human Z-DNA binding protein 1 (ZBP1), transcript variant 4 |
USD 460.00 |
|
RC228180L3 | Lenti-ORF clone of ZBP1 (Myc-DDK-tagged)-Human Z-DNA binding protein 1 (ZBP1), transcript variant 4 |
USD 620.00 |
|
RC228180L4 | Lenti-ORF clone of ZBP1 (mGFP-tagged)-Human Z-DNA binding protein 1 (ZBP1), transcript variant 4 |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review