Z DNA binding protein (ZBP1) (NM_001160419) Human Untagged Clone

CAT#: SC326815

ZBP1 (untagged)-Human Z-DNA binding protein 1 (ZBP1) transcript variant 4


  "NM_001160419" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "ZBP1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ZBP1
Synonyms C20orf183; DAI; DLM-1; DLM1
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_001160419, the custom clone sequence may differ by one or more nucleotides
ATGGCCCAGGCTCCTGCTGACCCGGGCAGAGAAGGCCACCTTGAACAAAGAATCCTGCAG
GTGCTGACAGAGGCTGGCTCCCCGGTGAAACTTGCCCAGCTGGTGAAGGAATGCCAAGCA
CCCAAGAGGGAGCTCAACCAAGTCCTCTACCGAATGAAAAAGGAGTTGAAAGTCTCCCTC
ACATCCCCTGCCACCTGGTGCTTGGGCGGGACTGATCCTGAAGGCGAGGGTCCTGCAGAG
CTGGCCTTGTCCAGCCCTGCCGAGAGGCCCCAGCAACATGCAGCTACAATTCCAGAGACC
CCTGGCCCTCAGTTCAGCCAACAACGGGAGGAAGACATCTACAGGTTTCTCAAAGACAAT
GGTCCCCAGAGGGCCCTGGTCATCGCCCAAGCACTGGGAATGAGGACAGCAAAAGATGTG
AACCGAGACTTGTACAGGATGAAGAGCAGGCACCTTCTGGACATGGATGAGCAGTCCAAA
GCATGGACGATTTACCGCCCAGAAGATTCTGGAAGAAGAGCAAAGTCAGCCTCAATTATT
TACCAGCACAATCCAATCAACATGATCTGCCAGAATGGACCCAACAGCTGGATTTCCATT
GCAAACTCCGAAGCCATCCAGATTGGACACGGGAACATCATTACAAGACAGACAGTCTCC
AGGGAGGACGGTAAGTCACCCAAGAGAGCCCAGGGAGGGGACCTCGGTGGGGAGCCACCG
GATCCTCTGGGTGGGGGCAAAGGG
Restriction Sites Please inquire     
ACCN NM_001160419
ORF Size 747 bp
Insert Size 1255
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001160419.1, NP_001153891.1
RefSeq Size 1255
RefSeq ORF 747
Locus ID 81030
Protein Pathways Cytosolic DNA-sensing pathway
Gene Summary This gene encodes a Z-DNA binding protein. The encoded protein plays a role in the innate immune response by binding to foreign DNA and inducing type-I interferon production. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
Transcript Variant: This variant (4) differs in the 3' coding region and 3' UTR, compared to variant 1. The encoded isoform (d) is shorter and has a distinct C-terminus compared to isoform a.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.