SVH (ARMC10) (NM_001161012) Human Untagged Clone

CAT#: SC326816

ARMC10 (untagged)-Human armadillo repeat containing 10 (ARMC10) transcript variant D


  "NM_001161012" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "ARMC10"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ARMC10
Synonyms PNAS-112; PNAS112; PSEC0198; SVH
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_001161012, the custom clone sequence may differ by one or more nucleotides
ATGGGTGGCCCCCGGGGCGCGGGCTGGGTGGCGGCGGGCCTGCTGCTCGGCGCGGGCGCC
TGCTACTGCATTTACAGGCTGACCCGGGGTCGGCGGCGGGGCGACCGCGAGCTCGGGATA
CGCTCTTCGAAGTCCGCAGAAGACTTAACTGATGGTTCATATGATGATGTTCTAAATGCT
GAACAACTTCAGAAACTCCTTTACCTGCTGGAGTCAACGGAGGATCCTGTAATTATTGAA
AGAGCTTTGATTACTTTGGGTAACAATGCAGCCTTTTCAGTTAACCAAGCTATTATTCGT
GAATTGGGTGGTATTCCAATTGTTGCAAACAAAATCAACCATTCCAACCAGAGTATTAAA
GAGAAAGCTTTAAATGCACTAAATAACCTGAGTGTGAATGTTGAAAATCAAATCAAGATA
AAGGTGCAAGTTTTGAAACTGCTTTTGAATTTGTCTGAAAATCCAGCCATGACAGAAGGA
CTTCTCCGTGCCCAAGTGGATTCATCATTCCTTTCCCTTTATGACAGCCACGTAGCAAAG
GAGATTCTTCTTCGAGTACTTACGCTATTTCAGAATATAAAGAACTGCCTCAAAATAGAA
GGCCATTTAGCTGTGCAGCCTACTTTCACTGAAGGTTCATTGTTTTTCCTGTTACATGGA
GAAGAATGTGCCCAGAAAATAAGAGCTTTAGTTGATCACCATGATGCAGAGGTGAAGGAA
AAGGTTGTAACAATAATACCCAAAATC
Restriction Sites Please inquire     
ACCN NM_001161012
ORF Size 750 bp
Insert Size 2369
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001161012.1, NP_001154484.1
RefSeq Size 2369
RefSeq ORF 750
Locus ID 83787
Protein Families Transmembrane
Gene Summary This gene encodes a protein that contains an armadillo repeat and transmembrane domain. The encoded protein decreases the transcriptional activity of the tumor suppressor protein p53 through direct interaction with the DNA-binding domain of p53, and may play a role in cell growth and survival. Upregulation of this gene may play a role in hepatocellular carcinoma. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 3. [provided by RefSeq, Sep 2011]
Transcript Variant: This variant (D) lacks two in-frame exons in the coding region compared to variant A. This results in a shorter protein (isoform d) compared to isoform a.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.