SVH (ARMC10) (NM_001161010) Human Untagged Clone

CAT#: SC326851

ARMC10 (untagged)-Human armadillo repeat containing 10 (ARMC10) transcript variant C

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ARMC10
• Synonyms: PNAS-112; PNAS112; PSEC0198; SVH
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001161010, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGGTGGCCCCCGGGGCGCGGGCTGGGTGGCGGCGGGCCTGCTGCTCGGCGCGGGCGCCTGCTACTGCA
  TTTACAGGCTGACCCGGGGTCGGCGGCGGGGCGACCGCGAGCTCGGGATACGCTCTTCGAAGTCCGCAGG
  TGCCCTGGAAGAAGGGACGTCAGAGGGTCAGTTGTGCGGGCGCTCGGCCCGGCCTCAGACGGGAGGTACC
  TGGGAGTCACAGTGGTCCAAGACCTCGCAGCCTGAAGACTTAACTGATGGTTCATATGATGATGTTCTAA
  ATGCTGAACAACTTCAGAAACTCCTTTACCTGCTGGAGTCAACGGAGGATCCTGTAATTATTGAAAGAGC
  TTTGATTACTTTGGGTAACAATGCAGCCTTTTCAGTTAACCAAGCTATTATTCGTGAATTGGGTGGTATT
  CCAATTGTTGCAAACAAAATCAACCATTCCAACCAGAGTATTAAAGAGAAAGCTTTAAATGCACTAAATA
  ACCTGAGTGTGAATGTTGAAAATCAAATCAAGATAAAGGTGCAAGTTTTGAAACTGCTTTTGAATTTGTC
  TGAAAATCCAGCCATGACAGAAGGACTTCTCCGTGCCCAAGTGGATTCATCATTCCTTTCCCTTTATGAC
  AGCCACGTAGCAAAGGAGATTCTTCTTCGAGTACTTACGCTATTTCAGAATATAAAGAACTGCCTCAAAA
  TAGAAGGCCATTTAGCTGTGCAGCCTACTTTCACTGAAGGTTCATTGTTTTTCCTGTTACATGGAGAAGA
  ATGTGCCCAGAAAATAAGAGCTTTAGTTGATCACCATGATGCAGAGGTGAAGGAAAAGGTTGTAACAATA
  ATACCCAAAATCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001161010
• ORF Size: 855 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001161010.2, NP_001154482.1
• RefSeq Size: 2474
• RefSeq ORF: 855
• Locus ID: 83787
• Protein Families: Transmembrane
• Gene Summary: This gene encodes a protein that contains an armadillo repeat and transmembrane domain. The encoded protein decreases the transcriptional activity of the tumor suppressor protein p53 through direct interaction with the DNA-binding domain of p53, and may play a role in cell growth and survival. Upregulation of this gene may play a role in hepatocellular carcinoma. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 3. [provided by RefSeq, Sep 2011]
  Transcript Variant: This variant (C) lacks an in-frame exon in the 3' coding region compared to variant A. This results in a shorter protein (isoform c) compared to isoform a.