Collagen XI alpha 2 (COL11A2) (NM_001163771) Human Untagged Clone

CAT#: SC326861

COL11A2 (untagged)-Human collagen type XI alpha 2 (COL11A2) transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: COL11A2
• Synonyms: DFNA13; DFNB53; FBCG2; HKE5; OSMEDA; OSMEDB; PARP; STL3
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001163771, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGAGCGGTGCAGCCGCTGCCATCGCCTCCTCCTCCTCCTACCTCTGGTGCTGGGGCTGAGCGCGGCCC
  CAGGCTGGGCAGGTGCACCCCCTGTGGATGTGCTCCGGGCCCTGAGGTTCCCCTCCCTCCCTGATGGTGT
  CCGGAGAGCGAAAGGCATCTGTCCAGCTGATGTGGCCTACCGAGTGGCACGACCTGCCCAGCTCAGTGCA
  CCCACTCGCCAGCTTTTCCCAGGAGGATTTCCCAAAGATTTCTCTCTGCTGACTGTTGTCCGGACCCGCC
  CTGGTCTCCAAGCTCCCCTCCTGACTCTCTACAGTGCCCAGGGTGTCCGACAGCTGGGCCTGGAGCTGGG
  CCGACCTGTCCGCTTCCTGTATGAAGACCAGACTGGGCGGCCTCAACCTCCCTCTCAGCCAGTCTTCCGA
  GGCCTCAGCCTAGCAGATGGCAAGTGGCACCGTGTGGCTGTGGCTGTGAAGGGCCAGTCTGTCACCCTCA
  TTGTTGACTGCAAGAAGCGAGTCACCCGGCCTCTCCCCCGAAGTGCTCGTCCAGTATTGGACACCCATGG
  AGTGATCATCTTTGGTGCCCGTATTCTGGATGAAGAAGTCTTTGAGGGTGATGTCCAGGAGCTGGCCATT
  GTCCCAGGGGTCCAGGCAGCCTATGAATCATGTGAACAGAAGGAGCTGGAATGCGAGGGGGGCCAGAGGG
  AAAGACCCCAAAACCAACAGCCTCACAGAGCCCAGAGATCTCCACAGCAGCAACCATCAAGACTTCACAG
  GCCACAAAATCAGGAACCCCAGAGCCAGGTGAGGGAGCTGGGAGAACCCCCAAGTGCAGCACACCCCAGA
  GAGGGAAGACACCCAGGCATCTCTCCTCCTTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001163771
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001163771.1, NP_001157243.1
• RefSeq Size: 1237 bp
• RefSeq ORF: 873 bp
• Locus ID: 1302
• Cytogenetics: 6p21.32
• Protein Families: Druggable Genome, Transmembrane
• Protein Pathways: ECM-receptor interaction, Focal adhesion
• Gene Summary: 'This gene encodes one of the two alpha chains of type XI collagen, a minor fibrillar collagen. It is located on chromosome 6 very close to but separate from the gene for retinoid X receptor beta. Type XI collagen is a heterotrimer but the third alpha chain is a post-translationally modified alpha 1 type II chain. Proteolytic processing of this type XI chain produces PARP, a proline/arginine-rich protein that is an amino terminal domain. Mutations in this gene are associated with type III Stickler syndrome, otospondylomegaepiphyseal dysplasia (OSMED syndrome), Weissenbacher-Zweymuller syndrome, autosomal dominant non-syndromic sensorineural type 13 deafness (DFNA13), and autosomal recessive non-syndromic sensorineural type 53 deafness (DFNB53). Alternative splicing results in multiple transcript variants. A related pseudogene is located nearby on chromosome 6. [provided by RefSeq, Jul 2009]'
  Transcript Variant: This variant (4) lacks several exons at the 3' end and has a distinct 3' coding region and 3' UTR, compared to variant 1. The encoded isoform (4) has a distinct C-terminus and is considerably shorter than isoform 1.