BCAT2 (NM_001164773) Human Untagged Clone

CAT#: SC326869

BCAT2 (untagged)-Human branched chain aminotransferase 2 mitochondrial (BCAT2) transcript variant b

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: BCAT2
• Synonyms: BCAM; BCATM; BCT2; PP18
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001164773, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCCGCAGCCGCTCTGGGGCAGCTGTTTGAGGGCATGAAGGCGTTCAAAGGCAAAGACCAGCAGGTGC
  GCCTCTTCCGCCCCTGGCTCAACATGGACCGGATGCTGCGCTCAGCCATGCGCCTGTGCCTGCCGAGTTT
  CGACAAGCTGGAGTTGCTGGAGTGCATCCGCCGGCTCATCGAAGTGGACAAGGACTGGGTCCCCGATGCC
  GCCGGCACCAGCCTCTATGTGCGGCCTGTGCTCATTGGGAACGAGCCCTCGCTGGGTGTCAGCCAGCCCA
  CGCGCGCGCTCCTGTTCGTCATTCTCTGCCCAGTGGGTGCCTACTTCCCTGGAGGCTCCGTGACCCCGGT
  CTCCCTCCTGGCCGACCCAGCCTTCATCCGGGCCTGGGTGGGCGGGGTCGGCAACTACAAGTTAGGTGGG
  AATTATGGGCCCACCGTGTTAGTGCAACAGGAGGCACTCAAGCGGGGCTGTGAACAGGTCCTCTGGCTGT
  ATGGGCCCGACCACCAGCTCACCGAGGTGGGAACCATGAACATCTTTGTCTACTGGACCCACGAAGATGG
  GGTGCTGGAGCTGGTGACGCCCCCGCTGAATGGTGTTATCCTGCCTGGAGTGGTCAGACAGAGTCTACTG
  GACATGGCTCAGACCTGGGGTGAGTTCCGGGTGGTGGAGCGCACGATCACCATGAAGCAGTTGCTGCGGG
  CCCTGGAGGAGGGCCGCGTGCGGGAAGTCTTTGGCTCGGGCACCGCTTGCCAGGTCTGCCCAGTGCACCG
  AATCCTGTACAAAGACAGGAACCTCCACATTCCCACCATGGAAAATGGGCCTGAGCTGATCCTCCGCTTC
  CAGAAGGAGCTGAAGGAGATCCAGTACGGAATCAGAGCCCACGAGTGGATGTTCCCGGTGTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001164773
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001164773.1, NP_001158245.1
• RefSeq Size: 1340 bp
• RefSeq ORF: 903 bp
• Locus ID: 587
• Cytogenetics: 19q13.33
• Protein Families: Druggable Genome
• Protein Pathways: Metabolic pathways, Pantothenate and CoA biosynthesis, Valine, leucine and isoleucine biosynthesis, Valine, leucine and isoleucine degradation
• Gene Summary: 'This gene encodes a branched chain aminotransferase found in mitochondria. The encoded protein forms a dimer that catalyzes the first step in the production of the branched chain amino acids leucine, isoleucine, and valine. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]'
  Transcript Variant: This variant (b) lacks two alternate in-frame exons in the 5' coding region, compared to variant a. The resulting isoform (b), also known as PP18b, lacks an internal segment near the N-terminus, compared to isoform a, which disrupts the transit peptide. This isoform is found in the cytosol.