LEF1 (NM_001166119) Human Untagged Clone

CAT#: SC326872

LEF1 (untagged)-Human lymphoid enhancer-binding factor 1 (LEF1) transcript variant 4


  "NM_001166119" in other vectors (4)

Reconstitution Protocol

USD 660.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "LEF1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol LEF1
Synonyms LEF-1; TCF1ALPHA; TCF7L3; TCF10
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_001166119, the custom clone sequence may differ by one or more nucleotides
ATGGCAGAGGTGGCCAGACAAGCACAAACCTCTCAGGAGCCCTACCACGACAAGGCCAGA
GAACACCCCGATGACGGAAAGCATCCAGATGGAGGCCTCTACAACAAGGGACCCTCCTAC
TCGAGTTATTCCGGGTACATAATGATGCCAAATATGAATAACGACCCATACATGTCAAAT
GGATCTCTTTCTCCACCCATCCCGAGAACATCAAATAAAGTGCCCGTGGTGCAGCCATCC
CATGCGGTCCATCCTCTCACCCCCCTCATCACTTACAGTGACGAGCACTTTTCTCCAGGA
TCACACCCGTCACACATCCCATCAGATGTCAACTCCAAACAAGGCATGTCCAGACATCCT
CCAGCTCCTGATATCCCTACTTTTTATCCCTTGTCTCCGGGTGGTGTTGGACAGATCACC
CCACCTCTTGGCTGGTTTTCCCATCATATGATTCCCGGTCCTCCTGGTCCCCACACAACT
GGCATCCCTCATCCAGCTATTGTAACACCTCAGGTCAAACAGGAACATCCCCACACTGAC
AGTGACCTAATGCACGTGAAGCCTCAGCATGAACAGAGAAAGGAGCAGGAGCCAAAAAGA
CCTCACATTAAGAAGCCTCTGAATGCTTTTATGTTATACATGAAAGAAATGAGAGCGAAT
GTCGTTGCTGAGTGTACTCTAAAAGAAAGTGCAGCTATCAACCAGATTCTTGGCAGAAGG
TGGCATGCCCTCTCCCGTGAAGAGCAGGCTAAATATTATGAATTAGCACGGAAAGAAAGA
CAGCTACATATGCAGCTTTATCCAGGCTGGTCTGCAAGAGACAATTATGGTAAGAAAAAG
AAGAGGAAGAGAGAGAAACTACAGGAATCTGCATCAGGTACAGGTCCAAGAATGACAGCT
GCCTACATC
Restriction Sites Please inquire     
ACCN NM_001166119
ORF Size 912 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001166119.1, NP_001159591.1
RefSeq Size 2660
RefSeq ORF 912
Locus ID 51176
Protein Families Adult stem cells, Druggable Genome, ES Cell Differentiation/IPS, Transcription Factors
Protein Pathways Acute myeloid leukemia, Adherens junction, Arrhythmogenic right ventricular cardiomyopathy (ARVC), Basal cell carcinoma, Colorectal cancer, Endometrial cancer, Melanogenesis, Pathways in cancer, Prostate cancer, Thyroid cancer, Wnt signaling pathway
Gene Summary This gene encodes a transcription factor belonging to a family of proteins that share homology with the high mobility group protein-1. The protein encoded by this gene can bind to a functionally important site in the T-cell receptor-alpha enhancer, thereby conferring maximal enhancer activity. This transcription factor is involved in the Wnt signaling pathway, and it may function in hair cell differentiation and follicle morphogenesis. Mutations in this gene have been found in somatic sebaceous tumors. This gene has also been linked to other cancers, including androgen-independent prostate cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
Transcript Variant: This variant (4) differs in the 5' UTR and 5' coding region, and lacks an alternate in-frame exon in the central coding region, compared to variant 1. The encoded isoform (4) has a distinct N-terminus and is shorter than isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.