GLRB (NM_001166061) Human Untagged Clone

CAT#: SC326873

GLRB (untagged)-Human glycine receptor beta (GLRB) transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: GLRB
• Synonyms: HKPX2
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001166061, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAAGTTTTTATTGACAACTGCCTTTTTAATTTTAATTTCCTTGTGGGTGGAAGAAGCCTATTCTAAGG
  AAAAGTCTTCAAAGAAAGGGAAGGGGAAAAAGAAGCAGTATCTATGCCCATCTCAGCAGTCAGCAGAGGA
  CCTTGCCCGAGTACCTGCCAACTCCACTAGCAATATCTTGAACAGGTTATTGGTCAGTTATGATCCCAGG
  ATAAGACCAAACTTCAAAGGCATTCCTGTTGATGTAGTAGTCAACATTTTTATTAACAGTTTTGGATCCA
  TTCAAGAAACAACAATGGACTATAGAGTTAACATCTTCCTGAGACAAAAATGGAATGACCCCAGGCTGAA
  GCTCCCCAGTGATTTTAGGGGTTCAGATGCACTGACAGTGGATCCAACAATGTACAAGTGTTTATGGAAA
  CCTGATTTATTTTTTGCAAATGAAAAAAGTGCCAATTTTCATGATGTGACCCAGGAAAACATCCTCCTCT
  TTATTTTTCGTGATGGAGATGTCCTTGTCAGCATGAGGTTATCTATTACTCTTTCATGCCCTTTGGACTT
  GACATTGTTTCCCATGGATACACAACGTTGCAAGATGCAACTGGAGAGCTTTGGTTACACAACTGATGAT
  TTACGATTTATCTGGCAGTCAGGAGATCCTGTGCAATTAGAAAAAATTGCCTTGCCTCAATTTGATATCA
  AAAAGGAAGATATTGAATATGGTAACTGTACAAAATACTATAAAGGCACGGGCTACTACACATGCGTGGA
  AGTCATCTTCACCCTGAGGAGGCAGGTCGGCTTTTACATGATGGGGGTCTACGCCCCAACCCTGCTCATT
  GTTGTTCTCTCCTGGCTTTCCTTCTGGATCAACCCGGACGCGAGTGCTGCCAGAGTGCCCCTGGGTTGGT
  GA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001166061
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001166061.1, NP_001159533.1
• RefSeq Size: 2783 bp
• RefSeq ORF: 912 bp
• Locus ID: 2743
• Cytogenetics: 4q32.1
• Protein Families: Druggable Genome, Ion Channels: Cys-loop Receptors, Transmembrane
• Protein Pathways: Neuroactive ligand-receptor interaction
• Gene Summary: 'This gene encodes the beta subunit of the glycine receptor, which is a pentamer composed of alpha and beta subunits. The receptor functions as a neurotransmitter-gated ion channel, which produces hyperpolarization via increased chloride conductance due to the binding of glycine to the receptor. Mutations in this gene cause startle disease, also known as hereditary hyperekplexia or congenital stiff-person syndrome, a disease characterized by muscular rigidity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]'
  Transcript Variant: This variant (3, also known as GlyR beta delta8) lacks an alternate internal exon that causes a frameshift in the 3' coding region, compared to variant 1. The encoded isoform (B) has a distinct C-terminus and is shorter than isoform A.