NRG1 (NM_001159996) Human Untagged Clone
CAT#: SC326876
NRG1 (untagged)-Human neuregulin 1 (NRG1) transcript variant ndf43c
"NM_001159996" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | NRG1 |
Synonyms | ARIA; GGF; GGF2; HGL; HRG; HRG1; HRGA; MST131; MSTP131; NDF; NRG1-IT2; SMDF |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001159996, the custom clone sequence may differ by one or more nucleotides
ATGCAGATTCCTAAACACATAAGCATTGAAGATATTACAGCTACATCTACATCCACCACTGGGACAAGCC ATCTTGTAAAATGTGCGGAGAAGGAGAAAACTTTCTGTGTGAATGGAGGGGAGTGCTTCATGGTGAAAGA CCTTTCAAACCCCTCGAGATACTTGTGCAAGTGCCAACCTGGATTCACTGGAGCAAGATGTACTGAGAAT GTGCCCATGAAAGTCCAAAACCAAGAAAAGGCGGAGGAGCTGTACCAGAAGAGAGTGCTGACCATAACCG GCATCTGCATCGCCCTCCTTGTGGTCGGCATCATGTGTGTGGTGGCCTACTGCAAAACCAAGAAACAGCG GAAAAAGCTGCATGACCGTCTTCGGCAGAGCCTTCGGTCTGAACGAAACAATATGATGAACATTGCCAAT GGGCCTCACCATCCTAACCCACCCCCCGAGAATGTCCAGCTGGTGAATCAATACGTATCTAAAAACGTCA TCTCCAGTGAGCATATTGTTGAGAGAGAAGCAGAGACATCCTTTTCCACCAGTCACTATACTTCCACAGC CCATCACTCCACTACTGTCACCCAGACTCCTAGCCACAGCTGGAGCAACGGACACACTGAAAGCATCCTT TCCGAAAGCCACTCTGTAATCGTGATGTCATCCGTAGAAAACAGTAGGCACAGCAGCCCAACTGGGGGCC CAAGAGGACGTCTTAATGGCACAGGAGGCCCTCGTGAATGTAACAGCTTCCTCAGGCATGCCAGAGAAAC CCCTGATTCCTACCGAGACTCTCCTCATAGTGAAAGACATAACCTTATAGCTGAGCTAAGGAGAAACAAG GCACACAGATCCAAATGCATGCAGATCCAGCTATCAGCAACTCATCTTAGATCTTCTTCCATTCCCCATT TGGGCTTCATTCTCTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001159996 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001159996.2, NP_001153468.1 |
RefSeq Size | 5425 bp |
RefSeq ORF | 927 bp |
Locus ID | 3084 |
Cytogenetics | 8p12 |
Protein Families | Druggable Genome, Secreted Protein, Transcription Factors, Transmembrane |
Protein Pathways | ErbB signaling pathway |
Gene Summary | 'The protein encoded by this gene is a membrane glycoprotein that mediates cell-cell signaling and plays a critical role in the growth and development of multiple organ systems. An extraordinary variety of different isoforms are produced from this gene through alternative promoter usage and splicing. These isoforms are expressed in a tissue-specific manner and differ significantly in their structure, and are classified as types I, II, III, IV, V and VI. Dysregulation of this gene has been linked to diseases such as cancer, schizophrenia, and bipolar disorder (BPD). [provided by RefSeq, Apr 2016]' Transcript Variant: This variant (ndf43c), which uses the type VI promoter, lacks multiple 5' exons but contains an alternate 5' terminal exon, and it also lacks two in-frame exons in the central coding region and includes an additional exon that results in an alternate 3' coding region, compared to variant HRG-beta1. The resulting isoform (ndf43c, also known as ndf43) has distinct N- and C-termini, lacks an internal segment, and is shorter than isoform HRG-beta1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC228241 | NRG1 (Myc-DDK-tagged)-Human neuregulin 1 (NRG1), transcript variant ndf43c |
USD 420.00 |
|
RG228241 | NRG1 (GFP-tagged) - Human neuregulin 1 (NRG1), transcript variant ndf43c |
USD 460.00 |
|
RC228241L3 | Lenti ORF clone of Human neuregulin 1 (NRG1), transcript variant ndf43c, Myc-DDK-tagged |
USD 620.00 |
|
RC228241L4 | Lenti ORF clone of Human neuregulin 1 (NRG1), transcript variant ndf43c, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review