SHOX2 (NM_001163678) Human Untagged Clone

CAT#: SC326888

SHOX2 (untagged)-Human short stature homeobox 2 (SHOX2) transcript variant 3


  "NM_001163678" in other vectors (6)

Reconstitution Protocol

USD 660.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "SHOX2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol SHOX2
Synonyms OG12; OG12X; SHOT
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001163678, the custom clone sequence may differ by one or more nucleotides


ATGGAAGAACTTACGGCGTTCGTCTCCAAGTCTTTTGACCAGAAAGTGAAGGAGAAGAAGGAGGCGATCA
CGTACCGGGAGGTGCTGGAGAGCGGGCCGCTGCGCGGGGCCAAGGAGCCGACCGGCTGCACCGAGGCGGG
CCGCGACGACCGCAGCAGCCCGGCAGTCCGGGCGGCCGGCGGAGGCGGCGGCGGAGGAGGCGGAGGCGGC
GGCGGAGGAGGCGGAGGAGGTGTAGGAGGAGGAGGAGCAGGCGGAGGAGCTGGAGGAGGGCGCTCTCCCG
TCCGGGAGCTGGACATGGGCGCCGCCGAGAGAAGCAGGGAGCCGGGCAGCCCGCGACTGACGGAGGTGTC
CCCGGAGCTGAAAGATCGCAAAGAGGATGCGAAAGGGATGGAGGACGAAGGCCAGACCAAAATCAAGCAG
AGGCGAAGTCGGACCAATTTCACCCTGGAACAACTCAATGAGCTGGAGAGGCTTTTTGACGAGACCCACT
ATCCCGACGCCTTCATGCGAGAGGAACTGAGCCAGCGACTGGGCCTGTCGGAGGCCCGAGTGCAGGTTTG
GTTTCAAAATCGAAGAGCTAAATGTAGAAAACAAGAAAATCAACTCCATAAAGGTGTTCTCATAGGGGCC
GCCAGCCAGTTTGAAGCTTGTAGAGTCGCACCTTATGTCAACGTAGGTGCTTTAAGGATGCCATTTCAGC
AGGTTCAGGCGCAGCTGCAGCTGGACAGCGCTGTGGCGCACGCGCACCACCACCTGCATCCGCACCTGGC
CGCGCACGCGCCCTACATGATGTTCCCAGCACCGCCCTTCGGACTGCCGCTCGCCACGCTGGCCGCGGAT
TCGGCTTCCGCCGCCTCGGTAGTGGCGGCCGCAGCAGCCGCCAAGACCACCAGCAAGAACTCCAGCATCG
CCGATCTCAGACTGAAAGCCAAAAAGCACGCCGCAGCCCTGGGTCTGTGA


Restriction Sites SgfI-MluI     
ACCN NM_001163678
ORF Size 960 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001163678.1, NP_001157150.1
RefSeq Size 3125
RefSeq ORF 960
Locus ID 6474
Protein Families Transcription Factors
Gene Summary This gene is a member of the homeobox family of genes that encode proteins containing a 60-amino acid residue motif that represents a DNA binding domain. Homeobox genes have been characterized extensively as transcriptional regulators involved in pattern formation in both invertebrate and vertebrate species. Several human genetic disorders are caused by aberrations in human homeobox genes. This locus represents a pseudoautosomal homeobox gene that is thought to be responsible for idiopathic short stature, and it is implicated in the short stature phenotype of Turner syndrome patients. This gene is considered to be a candidate gene for Cornelia de Lange syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2009]
Transcript Variant: This variant (3) lacks an alternate in-frame exon and uses an alternate in-frame splice site in the coding region, compared to variant 1, resulting in an isoform (c) that is shorter than isoform b. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.