SHOX2 (NM_001163678) Human Untagged Clone
CAT#: SC326888
SHOX2 (untagged)-Human short stature homeobox 2 (SHOX2) transcript variant 3
"NM_001163678" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | SHOX2 |
Synonyms | OG12; OG12X; SHOT |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001163678, the custom clone sequence may differ by one or more nucleotides
ATGGAAGAACTTACGGCGTTCGTCTCCAAGTCTTTTGACCAGAAAGTGAAGGAGAAGAAGGAGGCGATCA CGTACCGGGAGGTGCTGGAGAGCGGGCCGCTGCGCGGGGCCAAGGAGCCGACCGGCTGCACCGAGGCGGG CCGCGACGACCGCAGCAGCCCGGCAGTCCGGGCGGCCGGCGGAGGCGGCGGCGGAGGAGGCGGAGGCGGC GGCGGAGGAGGCGGAGGAGGTGTAGGAGGAGGAGGAGCAGGCGGAGGAGCTGGAGGAGGGCGCTCTCCCG TCCGGGAGCTGGACATGGGCGCCGCCGAGAGAAGCAGGGAGCCGGGCAGCCCGCGACTGACGGAGGTGTC CCCGGAGCTGAAAGATCGCAAAGAGGATGCGAAAGGGATGGAGGACGAAGGCCAGACCAAAATCAAGCAG AGGCGAAGTCGGACCAATTTCACCCTGGAACAACTCAATGAGCTGGAGAGGCTTTTTGACGAGACCCACT ATCCCGACGCCTTCATGCGAGAGGAACTGAGCCAGCGACTGGGCCTGTCGGAGGCCCGAGTGCAGGTTTG GTTTCAAAATCGAAGAGCTAAATGTAGAAAACAAGAAAATCAACTCCATAAAGGTGTTCTCATAGGGGCC GCCAGCCAGTTTGAAGCTTGTAGAGTCGCACCTTATGTCAACGTAGGTGCTTTAAGGATGCCATTTCAGC AGGTTCAGGCGCAGCTGCAGCTGGACAGCGCTGTGGCGCACGCGCACCACCACCTGCATCCGCACCTGGC CGCGCACGCGCCCTACATGATGTTCCCAGCACCGCCCTTCGGACTGCCGCTCGCCACGCTGGCCGCGGAT TCGGCTTCCGCCGCCTCGGTAGTGGCGGCCGCAGCAGCCGCCAAGACCACCAGCAAGAACTCCAGCATCG CCGATCTCAGACTGAAAGCCAAAAAGCACGCCGCAGCCCTGGGTCTGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001163678 |
ORF Size | 960 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001163678.1, NP_001157150.1 |
RefSeq Size | 3125 |
RefSeq ORF | 960 |
Locus ID | 6474 |
Protein Families | Transcription Factors |
Gene Summary | This gene is a member of the homeobox family of genes that encode proteins containing a 60-amino acid residue motif that represents a DNA binding domain. Homeobox genes have been characterized extensively as transcriptional regulators involved in pattern formation in both invertebrate and vertebrate species. Several human genetic disorders are caused by aberrations in human homeobox genes. This locus represents a pseudoautosomal homeobox gene that is thought to be responsible for idiopathic short stature, and it is implicated in the short stature phenotype of Turner syndrome patients. This gene is considered to be a candidate gene for Cornelia de Lange syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2009] Transcript Variant: This variant (3) lacks an alternate in-frame exon and uses an alternate in-frame splice site in the coding region, compared to variant 1, resulting in an isoform (c) that is shorter than isoform b. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC228253 | SHOX2 (Myc-DDK-tagged)-Human short stature homeobox 2 (SHOX2), transcript variant 3 |
USD 420.00 |
|
RG228253 | SHOX2 (GFP-tagged) - Human short stature homeobox 2 (SHOX2), transcript variant 3 |
USD 460.00 |
|
RC228253L1 | Lenti ORF clone of Human short stature homeobox 2 (SHOX2), transcript variant 3, Myc-DDK-tagged |
USD 768.00 |
|
RC228253L2 | Lenti ORF clone of Human short stature homeobox 2 (SHOX2), transcript variant 3, mGFP tagged |
USD 620.00 |
|
RC228253L3 | Lenti ORF clone of Human short stature homeobox 2 (SHOX2), transcript variant 3, Myc-DDK-tagged |
USD 620.00 |
|
RC228253L4 | Lenti ORF clone of Human short stature homeobox 2 (SHOX2), transcript variant 3, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review