ZDHHC15 (NM_001146256) Human Untagged Clone

CAT#: SC326894

ZDHHC15 (untagged)-Human zinc finger DHHC-type containing 15 (ZDHHC15) transcript variant 2


  "NM_001146256" in other vectors (6)

Reconstitution Protocol

USD 660.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "ZDHHC15"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ZDHHC15
Synonyms DHHC15; MRX91
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001146256, the custom clone sequence may differ by one or more nucleotides


ATGCGGCGAGGCTGGAAGATGGCTCTGTCTGGGGGGCTGCGGTGCTGCCGCCGGGTACTGTCCTGGGTGC
CAGTGCTCGTTATTGTCCTCGTCGTGCTCTGGTCCTACTATGCCTACGTCTTTGAACTCTGCCTGGTTAT
TTACCTCATACTCTACCATGCCATCTTTGTGTTCTTTACCTGGACCTACTGGAAGTCTATCTTTACACTC
CCACAGCAGCCAAACCAGAAGTTCCACTTGTCCTACACAGACAAGGAGCGCTATGAAAATGAAGAAAGAC
CTGAGGTCCAGAAGCAGATGCTTGTTGATATGGCCAAAAAGCTACCGGTTTACACAAGAACTGGAAGTGG
AGCTGTACGATTCTGTGACCGGTGTCATCTGATCAAGCCAGACCGCTGCCACCACTGCTCTGTCTGTGCT
ATGTGTGTGTTAAAAATGGATCATCACTGCCCTTGGGTTAATAACTGCATTGGATTTTCCAACTACAAAT
TCTTCCTTCAATTCTTAGCTTACTCTGTTCTCTACTGCCTGTACATTGCTACGACAGTCTTCAGCTATTT
CATCAAATACTGGAGAGGGGAATTACCCAGTGTTCGCTCTAAGTTCCATGTCCTTTTTCTTCTCTTTGTG
GCCTGCATGTTTTTTGTCAGCCTTGTGATTCTCTTTGGTTACCATTGTTGGCTTGTCAGCAGAAACAAAA
CCACCTTAGAGGCCTTCTGCACTCCAGTGTTTACAAGTGGCCCAGAGAAAAATGGGTTCAACCTTGGCTT
CATCAAGAATATCCAGCAGGTGTTTGGAGATAAGAAGAAGTTCTGGTTAATACCTATTGGTTCCAGCCCT
GGTGATGGACACTCCTTCCCTATGAGGTCTATGAATGAGTCACAGAACCCACTGCTAGCAAATGAAGAAA
CCTGGGAAGACAACGAGGATGACAACCAAGATTATCCAGAAGGCTCATCATCTCTTGCTGTGGAAACGGA
AACATAG


Restriction Sites SgfI-MluI     
ACCN NM_001146256
ORF Size 987 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001146256.1, NP_001139728.1
RefSeq Size 6030
RefSeq ORF 987
Locus ID 158866
Protein Families Transmembrane
Gene Summary The protein encoded by this gene belongs to the DHHC palmitoyltransferase family. Mutations in this gene are associated with mental retardatio X-linked type 91 (MRX91). Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
Transcript Variant: This variant (2) is lacking an in-frame coding exon compared to variant 1, resulting in a shorter isoform (2) missing a 9 aa segment compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.