ZDHHC15 (NM_001146256) Human Untagged Clone
CAT#: SC326894
ZDHHC15 (untagged)-Human zinc finger DHHC-type containing 15 (ZDHHC15) transcript variant 2
"NM_001146256" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | ZDHHC15 |
Synonyms | DHHC15; MRX91 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001146256, the custom clone sequence may differ by one or more nucleotides
ATGCGGCGAGGCTGGAAGATGGCTCTGTCTGGGGGGCTGCGGTGCTGCCGCCGGGTACTGTCCTGGGTGC CAGTGCTCGTTATTGTCCTCGTCGTGCTCTGGTCCTACTATGCCTACGTCTTTGAACTCTGCCTGGTTAT TTACCTCATACTCTACCATGCCATCTTTGTGTTCTTTACCTGGACCTACTGGAAGTCTATCTTTACACTC CCACAGCAGCCAAACCAGAAGTTCCACTTGTCCTACACAGACAAGGAGCGCTATGAAAATGAAGAAAGAC CTGAGGTCCAGAAGCAGATGCTTGTTGATATGGCCAAAAAGCTACCGGTTTACACAAGAACTGGAAGTGG AGCTGTACGATTCTGTGACCGGTGTCATCTGATCAAGCCAGACCGCTGCCACCACTGCTCTGTCTGTGCT ATGTGTGTGTTAAAAATGGATCATCACTGCCCTTGGGTTAATAACTGCATTGGATTTTCCAACTACAAAT TCTTCCTTCAATTCTTAGCTTACTCTGTTCTCTACTGCCTGTACATTGCTACGACAGTCTTCAGCTATTT CATCAAATACTGGAGAGGGGAATTACCCAGTGTTCGCTCTAAGTTCCATGTCCTTTTTCTTCTCTTTGTG GCCTGCATGTTTTTTGTCAGCCTTGTGATTCTCTTTGGTTACCATTGTTGGCTTGTCAGCAGAAACAAAA CCACCTTAGAGGCCTTCTGCACTCCAGTGTTTACAAGTGGCCCAGAGAAAAATGGGTTCAACCTTGGCTT CATCAAGAATATCCAGCAGGTGTTTGGAGATAAGAAGAAGTTCTGGTTAATACCTATTGGTTCCAGCCCT GGTGATGGACACTCCTTCCCTATGAGGTCTATGAATGAGTCACAGAACCCACTGCTAGCAAATGAAGAAA CCTGGGAAGACAACGAGGATGACAACCAAGATTATCCAGAAGGCTCATCATCTCTTGCTGTGGAAACGGA AACATAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001146256 |
ORF Size | 987 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001146256.1, NP_001139728.1 |
RefSeq Size | 6030 |
RefSeq ORF | 987 |
Locus ID | 158866 |
Protein Families | Transmembrane |
Gene Summary | The protein encoded by this gene belongs to the DHHC palmitoyltransferase family. Mutations in this gene are associated with mental retardatio X-linked type 91 (MRX91). Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009] Transcript Variant: This variant (2) is lacking an in-frame coding exon compared to variant 1, resulting in a shorter isoform (2) missing a 9 aa segment compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC228259 | ZDHHC15 (Myc-DDK-tagged)-Human zinc finger, DHHC-type containing 15 (ZDHHC15), transcript variant 2 |
USD 420.00 |
|
RG228259 | ZDHHC15 (GFP-tagged) - Human zinc finger, DHHC-type containing 15 (ZDHHC15), transcript variant 2 |
USD 460.00 |
|
RC228259L1 | Lenti ORF clone of Human zinc finger, DHHC-type containing 15 (ZDHHC15), transcript variant 2, Myc-DDK-tagged |
USD 768.00 |
|
RC228259L2 | Lenti ORF clone of Human zinc finger, DHHC-type containing 15 (ZDHHC15), transcript variant 2, mGFP tagged |
USD 620.00 |
|
RC228259L3 | Lenti ORF clone of Human zinc finger, DHHC-type containing 15 (ZDHHC15), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
RC228259L4 | Lenti ORF clone of Human zinc finger, DHHC-type containing 15 (ZDHHC15), transcript variant 2, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review