ER81 (ETV1) (NM_001163152) Human Untagged Clone
CAT#: SC326937
ETV1 (untagged)-Human ets variant 1 (ETV1) transcript variant 7
"NM_001163152" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | ETV1 |
Synonyms | ER81 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001163152, the custom clone sequence may differ by one or more nucleotides
ATGCTTCAAGATTTAAGTGCAAGTGTCTTCTTTCCACCTTGTTCACAACACAGAACGTTAGCTCAGGTAC CTGACAATGATGAGCAGTTTGTACCAGACTATCAGGCTGAAAGTTTGGCTTTTCATGGCCTGCCACTGAA AATCAAGAAAGAACCCCACAGTCCATGTTCAGAAATCAGCTCTGCCTGCAGTCAAGAACAGCCCTTTAAA TTCAGCTATGGAGAAAAGTGCCTGTACAATGTCAGATTTCGCCGCCAGCTTTCTGAACCCTGTAACTCCT TTCCTCCTTTGCCGACGATGCCAAGGGAAGGACGTCCTATGTACCAACGCCAGATGTCTGAGCCAAACAT CCCCTTCCCACCACAAGGCTTTAAGCAGGAGTACCACGACCCAGTGTATGAACACAACACCATGGTTGGC AGTGCGGCCAGCCAAAGCTTTCCCCCTCCTCTGATGATTAAACAGGAACCCAGAGATTTTGCATATGACT CAGAAGTGCCTAGCTGCCACTCCATTTATATGAGGCAAGAAGGCTTCCTGGCTCATCCCAGCAGAACAGA AGGCTGTATGTTTGAAAAGGGCCCCAGGCAGTTTTATGATGACACCTGTGTTGTCCCAGAAAAATTCGAT GGAGACATCAAACAAGAGCCAGGAATGTATCGGGAAGGACCCACATACCAACGGCGAGGATCACTTCAGC TCTGGCAGTTTTTGGTAGCTCTTCTGGATGACCCTTCAAATTCTCATTTTATTGCCTGGACTGGTCGAGG CATGGAATTTAAACTGATTGAGCCTGAAGAGGTGGCCCGACGTTGGGGCATTCAGAAAAACAGGCCAGCT ATGAACTATGATAAACTTAGCCGTTCACTCCGCTATTACTATGAGAAAGGAATTATGCAAAAGGTGGCTG GAGAGAGATATGTCTACAAGTTTGTGTGTGATCCAGAAGCCCTTTTCTCCATGGCCTTTCCAGATAATCA GCGTCCACTGCTGAAGACAGACATGGAACGTCACATCAACGAGGAGGACACAGTGCCTCTTTCTCACTTT GATGAGAGCATGGCCTACATGCCGGAAGGGGGCTGCTGCAACCCCCACCCCTACAACGAAGGCTACGTGT ATTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001163152 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001163152.1, NP_001156624.1 |
RefSeq Size | 6114 bp |
RefSeq ORF | 1125 bp |
Locus ID | 2115 |
Cytogenetics | 7p21.2 |
Protein Families | ES Cell Differentiation/IPS, Transcription Factors |
Gene Summary | 'This gene encodes a member of the ETS (E twenty-six) family of transcription factors. The ETS proteins regulate many target genes that modulate biological processes like cell growth, angiogenesis, migration, proliferation and differentiation. All ETS proteins contain an ETS DNA-binding domain that binds to DNA sequences containing the consensus 5'-CGGA[AT]-3'. The protein encoded by this gene contains a conserved short acidic transactivation domain (TAD) in the N-terminal region, in addition to the ETS DNA-binding domain in the C-terminal region. This gene is involved in chromosomal translocations, which result in multiple fusion proteins including EWS-ETV1 in Ewing sarcoma and at least 10 ETV1 partners (see PMID: 19657377, Table 1) in prostate cancer. In addition to chromosomal rearrangement, this gene is overexpressed in prostate cancer, melanoma and gastrointestinal stromal tumor. Multiple alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2016]' Transcript Variant: This variant (7) represents use of an alternate promoter, 5' UTR, 5' coding region, and lacks an alternate in-frame exon, compared to variant 1. The resulting isoform (f) has a shorter and distinct N-terminus and lacks an internal segment, compared to isoform a. This isoform lacks major part of the N-terminal TAD. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC228302 | ETV1 (Myc-DDK-tagged)-Human ets variant 1 (ETV1), transcript variant 7 |
USD 98.00 |
|
RG228302 | ETV1 (GFP-tagged) - Human ets variant 1 (ETV1), transcript variant 7 |
USD 460.00 |
|
RC228302L3 | Lenti ORF clone of Human ets variant 1 (ETV1), transcript variant 7, Myc-DDK-tagged |
USD 620.00 |
|
RC228302L4 | Lenti ORF clone of Human ets variant 1 (ETV1), transcript variant 7, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review