CCR3 (NM_178328) Human Untagged Clone
CAT#: SC326940
CCR3 (untagged)-Human chemokine (C-C motif) receptor 3 (CCR3) transcript variant 3
"NM_178328" in other vectors (4)
Product Images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Symbol | CCR3 |
| Synonyms | CC-CKR-3; CD193; CKR3; CMKBR3 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>NCBI ORF sequence for NM_178328, the custom clone sequence may differ by one or more nucleotides
ATGCCATTTGGAATAAGAATGCTGTTAAGAGCACACAAGCCAGGTTCCTCAAGGAGAAGTGAAATGACAA CCTCACTAGATACAGTTGAGACCTTTGGTACCACATCCTACTATGATGACGTGGGCCTGCTCTGTGAAAA AGCTGATACCAGAGCACTGATGGCCCAGTTTGTGCCCCCGCTGTACTCCCTGGTGTTCACTGTGGGCCTC TTGGGCAATGTGGTGGTGGTGATGATCCTCATAAAATACAGGAGGCTCCGAATTATGACCAACATCTACC TGCTCAACCTGGCCATTTCGGACCTGCTCTTCCTCGTCACCCTTCCATTCTGGATCCACTATGTCAGGGG GCATAACTGGGTTTTTGGCCATGGCATGTGTAAGCTCCTCTCAGGGTTTTATCACACAGGCTTGTACAGC GAGATCTTTTTCATAATCCTGCTGACAATCGACAGGTACCTGGCCATTGTCCATGCTGTGTTTGCCCTTC GAGCCCGGACTGTCACTTTTGGTGTCATCACCAGCATCGTCACCTGGGGCCTGGCAGTGCTAGCAGCTCT TCCTGAATTTATCTTCTATGAGACTGAAGAGTTGTTTGAAGAGACTCTTTGCAGTGCTCTTTACCCAGAG GATACAGTATATAGCTGGAGGCATTTCCACACTCTGAGAATGACCATCTTCTGTCTCGTTCTCCCTCTGC TCGTTATGGCCATCTGCTACACAGGAATCATCAAAACGCTGCTGAGGTGCCCCAGTAAAAAAAAGTACAA GGCCATCCGGCTCATTTTTGTCATCATGGCGGTGTTTTTCATTTTCTGGACACCCTACAATGTGGCTATC CTTCTCTCTTCCTATCAATCCATCTTATTTGGAAATGACTGTGAGCGGAGCAAGCATCTGGACCTGGTCA TGCTGGTGACAGAGGTGATCGCCTACTCCCACTGCTGCATGAACCCGGTGATCTACGCCTTTGTTGGAGA GAGGTTCCGGAAGTACCTGCGCCACTTCTTCCACAGGCACTTGCTCATGCACCTGGGCAGATACATCCCA TTCCTTCCTAGTGAGAAGCTGGAAAGAACCAGCTCTGTCTCTCCATCCACAGCAGAGCCGGAACTCTCTA TTGTGTTTTAG |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_178328 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_178328.1, NP_847898.1 |
| RefSeq Size | 1786 bp |
| RefSeq ORF | 1131 bp |
| Locus ID | 1232 |
| Cytogenetics | 3p21.31 |
| Protein Families | Druggable Genome, GPCR, Transmembrane |
| Protein Pathways | Chemokine signaling pathway, Cytokine-cytokine receptor interaction |
| Gene Summary | 'The protein encoded by this gene is a receptor for C-C type chemokines. It belongs to family 1 of the G protein-coupled receptors. This receptor binds and responds to a variety of chemokines, including eotaxin (CCL11), eotaxin-3 (CCL26), MCP-3 (CCL7), MCP-4 (CCL13), and RANTES (CCL5). It is highly expressed in eosinophils and basophils, and is also detected in TH1 and TH2 cells, as well as in airway epithelial cells. This receptor may contribute to the accumulation and activation of eosinophils and other inflammatory cells in the allergic airway. It is also known to be an entry co-receptor for HIV-1. This gene and seven other chemokine receptor genes form a chemokine receptor gene cluster on the chromosomal region 3p21. Alternatively spliced transcript variants have been described. [provided by RefSeq, Sep 2009]' Transcript Variant: This variant (3) has an alternate internal exon, which includes an upstream in-frame AUG start codon, as compared to variant 1. The resulting isoform (2) has a longer N-terminus, as compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC228305 | CCR3 (Myc-DDK-tagged)-Human chemokine (C-C motif) receptor 3 (CCR3), transcript variant 3 |
USD 420.00 |
|
| RG228305 | CCR3 (GFP-tagged) - Human chemokine (C-C motif) receptor 3 (CCR3), transcript variant 3 |
USD 460.00 |
|
| RC228305L3 | Lenti-ORF clone of CCR3 (Myc-DDK-tagged)-Human chemokine (C-C motif) receptor 3 (CCR3), transcript variant 3 |
USD 620.00 |
|
| RC228305L4 | Lenti-ORF clone of CCR3 (mGFP-tagged)-Human chemokine (C-C motif) receptor 3 (CCR3), transcript variant 3 |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review
Germany
Japan
United Kingdom
China