CCR3 (NM_178328) Human Untagged Clone

CAT#: SC326940

CCR3 (untagged)-Human chemokine (C-C motif) receptor 3 (CCR3) transcript variant 3


  "NM_178328" in other vectors (4)

Reconstitution Protocol

USD 650.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "CCR3"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CCR3
Synonyms CC-CKR-3; CD193; CKR3; CMKBR3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_178328, the custom clone sequence may differ by one or more nucleotides


ATGCCATTTGGAATAAGAATGCTGTTAAGAGCACACAAGCCAGGTTCCTCAAGGAGAAGTGAAATGACAA
CCTCACTAGATACAGTTGAGACCTTTGGTACCACATCCTACTATGATGACGTGGGCCTGCTCTGTGAAAA
AGCTGATACCAGAGCACTGATGGCCCAGTTTGTGCCCCCGCTGTACTCCCTGGTGTTCACTGTGGGCCTC
TTGGGCAATGTGGTGGTGGTGATGATCCTCATAAAATACAGGAGGCTCCGAATTATGACCAACATCTACC
TGCTCAACCTGGCCATTTCGGACCTGCTCTTCCTCGTCACCCTTCCATTCTGGATCCACTATGTCAGGGG
GCATAACTGGGTTTTTGGCCATGGCATGTGTAAGCTCCTCTCAGGGTTTTATCACACAGGCTTGTACAGC
GAGATCTTTTTCATAATCCTGCTGACAATCGACAGGTACCTGGCCATTGTCCATGCTGTGTTTGCCCTTC
GAGCCCGGACTGTCACTTTTGGTGTCATCACCAGCATCGTCACCTGGGGCCTGGCAGTGCTAGCAGCTCT
TCCTGAATTTATCTTCTATGAGACTGAAGAGTTGTTTGAAGAGACTCTTTGCAGTGCTCTTTACCCAGAG
GATACAGTATATAGCTGGAGGCATTTCCACACTCTGAGAATGACCATCTTCTGTCTCGTTCTCCCTCTGC
TCGTTATGGCCATCTGCTACACAGGAATCATCAAAACGCTGCTGAGGTGCCCCAGTAAAAAAAAGTACAA
GGCCATCCGGCTCATTTTTGTCATCATGGCGGTGTTTTTCATTTTCTGGACACCCTACAATGTGGCTATC
CTTCTCTCTTCCTATCAATCCATCTTATTTGGAAATGACTGTGAGCGGAGCAAGCATCTGGACCTGGTCA
TGCTGGTGACAGAGGTGATCGCCTACTCCCACTGCTGCATGAACCCGGTGATCTACGCCTTTGTTGGAGA
GAGGTTCCGGAAGTACCTGCGCCACTTCTTCCACAGGCACTTGCTCATGCACCTGGGCAGATACATCCCA
TTCCTTCCTAGTGAGAAGCTGGAAAGAACCAGCTCTGTCTCTCCATCCACAGCAGAGCCGGAACTCTCTA
TTGTGTTTTAG


Restriction Sites SgfI-MluI     
ACCN NM_178328
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_178328.1, NP_847898.1
RefSeq Size 1786 bp
RefSeq ORF 1131 bp
Locus ID 1232
Cytogenetics 3p21.31
Protein Families Druggable Genome, GPCR, Transmembrane
Protein Pathways Chemokine signaling pathway, Cytokine-cytokine receptor interaction
Gene Summary 'The protein encoded by this gene is a receptor for C-C type chemokines. It belongs to family 1 of the G protein-coupled receptors. This receptor binds and responds to a variety of chemokines, including eotaxin (CCL11), eotaxin-3 (CCL26), MCP-3 (CCL7), MCP-4 (CCL13), and RANTES (CCL5). It is highly expressed in eosinophils and basophils, and is also detected in TH1 and TH2 cells, as well as in airway epithelial cells. This receptor may contribute to the accumulation and activation of eosinophils and other inflammatory cells in the allergic airway. It is also known to be an entry co-receptor for HIV-1. This gene and seven other chemokine receptor genes form a chemokine receptor gene cluster on the chromosomal region 3p21. Alternatively spliced transcript variants have been described. [provided by RefSeq, Sep 2009]'
Transcript Variant: This variant (3) has an alternate internal exon, which includes an upstream in-frame AUG start codon, as compared to variant 1. The resulting isoform (2) has a longer N-terminus, as compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.