PAI1 (SERPINE1) (NM_001165413) Human Untagged Clone

CAT#: SC326946

SERPINE1 (untagged)-Human serpin peptidase inhibitor clade E (nexin plasminogen activator inhibitor type 1) member 1 (SERPINE1) transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: SERPINE1
• Synonyms: PAI; PAI-1; PAI1; PLANH1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001165413, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCAGATGTCTCCAGCCCTCACCTGCCTAGTCCTGGGCCTGGCCCTTGTCTTTGGTGAAGGGTCTGCTG
  TGCACCATCCCCCATCCTACGTGGCGCAGGCCTCCAAGGACCGCAACGTGGTTTTCTCACCCTATGGGGT
  GGCCTCGGTGTTGGCCATGCTCCAGCTGACAACAGGAGGAGAAACCCAGCAGCAGATTCAAGCAGCTATG
  GGATTCAAGATTGATGACAAGGGCATGGCCCCCGCCCTCCGGCATCTGTACAAGGAGCTCATGGGGCCAT
  GGAACAAGGATGAGATCAGCACCACAGACGCGATCTTCGTCCAGCGGGATCTGAAGCTGGTCCAGGGCTT
  CATGCCCCACTTCTTCAGGCTGTTCCGGAGCACGGTCAAGCAAGTGGACTTTTCAGAGGTGGAGAGAGCC
  AGATTCATCATCAATGACTGGGTGAAGACACACACAAAAGGTATGATCAGCAACTTGCTTGGGAAAGGAG
  CCGTGGACCAGCTGACACGGCTGGTGCTGGTGAATGCCCTCTACTTCAACGGCCAGTGGAAGACTCCCTT
  CCCCGACTCCAGCACCCACCGCCGCCTCTTCCACAAATCAGACGGCAGCACTGTCTCTGTGCCCATGATG
  GCTCAGACCAACAAGTTCAACTATACTGAGTTCACCACGCCCGATGGCCATTACTACGACATCCTGGAAC
  TGCCCTACCACGGGGACACCCTCAGCATGTTCATTGCTGCCCCTTATGAAAAAGAGGTGCCTCTCTCTGC
  CCTCACCAACATTCTGAGTGCCCAGCTCATCAGCCACTGGAAAGGCAACATGACCAGGCTGCCCCGCCTC
  CTGGTTCTGCCCAAGTTCTCCCTGGAGACTGAAGTCGACCTCAGGAAGCCCCTAGAGAACCTGGGAATGA
  CCGACATGTTCAGACAGTTTCAGGCTGACTTCACGAGTCTTTCAGACCAAGAGCCTCTCCACGTCGCGCA
  GGCGCTGCAGAAAGTGAAGATCGAGGTGAACGAGAGTGGCACGGTGGCCTCCTCATCCACAGCTGTCATA
  GTCTCAGCCCGCATGGCCCCCGAGGAGATCATCATGGACAGACCCTTCCTCTTTGTGGTCCGGCACAACC
  CCACAGGAACAGTCCTTTTCATGGGCCAAGTGATGGAACCCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001165413
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001165413.2, NP_001158885.1
• RefSeq Size: 3162 bp
• RefSeq ORF: 1164 bp
• Locus ID: 5054
• Cytogenetics: 7q22.1
• Protein Families: Druggable Genome, Secreted Protein
• Protein Pathways: Complement and coagulation cascades, p53 signaling pathway
• Gene Summary: 'This gene encodes a member of the serine proteinase inhibitor (serpin) superfamily. This member is the principal inhibitor of tissue plasminogen activator (tPA) and urokinase (uPA), and hence is an inhibitor of fibrinolysis. The protein also functions as a component of innate antiviral immunity. Defects in this gene are the cause of plasminogen activator inhibitor-1 deficiency (PAI-1 deficiency), and high concentrations of the gene product are associated with thrombophilia. [provided by RefSeq, Aug 2020]'
  Transcript Variant: This variant (2) lacks an in-frame coding segment in the 5' region, as compared to variant 1. The resulting isoform (2) is shorter than isoform 1.