PEPD (NM_001166057) Human Untagged Clone

CAT#: SC326980

PEPD (untagged)-Human peptidase D (PEPD) transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PEPD
• Synonyms: PROLIDASE
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001166057, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCGGCGGCCACCGGACCCTCGTTTTGGCTGGGGAATGAAACCCTGAAGGTGCCGCTGGCGCTCTTTG
  CCTTGAACCGGCAGCGCCTGTGTGAGCGGCTGCGGAAGAACCCTGCTGTGCAGGCCGGCTCCATCGTGGT
  CCTGCAGGGCGGGGAGGAGACTCAGCGCTACTGCACCGACACCGGGGTCCTCTTCCGCCAGATTGCCAGC
  GTCCTGACGTCACAGAAGCCCTCTGTCCTCCTCACTTTGCGTGGCGTCAACACGGACAGCGGCAGTGTCT
  GCAGGGAGGCCTCCTTTGACGGCATCAGCAAGTTCGAAGTCAACAATACCATTCTTCACCCAGAGATCGT
  TGAGTGCCGAGTGTTTAAGACGGATATGGAGCTGGAGGTTCTGCGCTATACCAATAAAATCTCCAGCGAG
  GCCCACCGTGAGGTAATGAAGGCTGTAAAAGTGGGAATGAAAGAATATGAGTTGGAAAGCCTCTTCGAGC
  ACTACTGCTACTCCCGGGGCGGCATGCGCCACAGCTCCTACACCTGCATCTGCGGCAGTGGTGAGAACTC
  AGCCGTGCTACACTACGGACACGCCGGAGCTCCCAACGACCGAACGATCCAGAATGGGGATATGTGCCTG
  TTCGACATGGGCGGTGAGTATTACTGCTTCGCTTCCGACATCACCTGCTCCTTTCCCGCCAACGGCAAGT
  TCACTGCAGACCAGAAGGCCGTCTATGAGGCAGTGCTGCGGAGCTCCCGTGCCGTCATGGGTGCCATGAA
  GCCAGGTGTCTGGTGGCCTGACATGCACCGCCTGGCTGACCGCATCCACCTGGAGGAGCTGGCCCACATG
  GGCATCCTGAGCGGCAGCGTGGACGCCATGGTCCAGGCTCACCTGGGGGCCGTGTTTATGCCTCACGGGC
  TTGGCCACTTCCTGGGCATTGACGTGCACGACGTGGGAGGCTACCCAGAGGGCGTGGAGCGCATCGACGA
  GCCCGGCCTGCGGAGCCTGCGCACTGCACGGCACCTGCAGCCAGGCATGGTGCTCACCGTGGAGCCGGGC
  ATCTACTTCATCGACCACCTCCTGGATGAGGCCCTGGCGGACCCGGCCCGCGCCTCCTTCCTTAACCGCG
  AGGTCCTGCAGCGCTTTCGCGGTTTTGGCGGGGTCCGCATCGAGGAGGACGTCGTGGTGACTGACAGCGG
  CATAGAGCTGCTGACCTGCGTGCCCCGCACTGTGGAAGAGATTGAAGCATGCATGGCAGGCTGTGACAAG
  GCCTTTACCCCCTTCTCTGGCCCCAAGTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001166057
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001166057.1, NP_001159529.1
• RefSeq Size: 1827 bp
• RefSeq ORF: 1290 bp
• Locus ID: 5184
• Cytogenetics: 19q13.11
• Protein Families: Druggable Genome, Protease
• Gene Summary: 'This gene encodes a member of the peptidase family. The protein forms a homodimer that hydrolyzes dipeptides or tripeptides with C-terminal proline or hydroxyproline residues. The enzyme serves an important role in the recycling of proline, and may be rate limiting for the production of collagen. Mutations in this gene result in prolidase deficiency, which is characterized by the excretion of large amount of di- and tri-peptides containing proline. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Oct 2009]'
  Transcript Variant: This variant (3) lacks two alternate in-frame exons in the central coding region, compared to variant 1. The resulting isoform (3) lacks an internal segment, compared to isoform 1.