IGF2BP1 (NM_001160423) Human Untagged Clone
CAT#: SC326984
IGF2BP1 (untagged)-Human insulin-like growth factor 2 mRNA binding protein 1 (IGF2BP1) transcript variant 2
"NM_001160423" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | IGF2BP1 |
Synonyms | CRD-BP; CRDBP; IMP-1; IMP1; VICKZ1; ZBP1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001160423, the custom clone sequence may differ by one or more nucleotides
ATGAACAAGCTTTACATCGGCAACCTCAACGAGAGCGTGACCCCCGCGGACTTGGAGAAAGTGTTTGCGG AGCACAAGATCTCCTACAGCGGCCAGTTCTTGGTCAAATCCGGCTACGCCTTCGTGGACTGCCCGGACGA GCACTGGGCGATGAAGGCCATCGAAACTTTCTCCGGGAAAGTAGAATTACAAGGAAAACGCTTAGAGATT GAACATTCGGTGCCCAAAAAACAAAGGAGCCGGAAAATTCAAATCCGAAATATTCCACCCCAGCTCCGAT GGGAAGTACTGGACAGCCTGCTGGCTCAGTATGGTACAGTAGAGAACTGTGAGCAAGTGAACACCGAGAG TGAGACGGCAGTGGTGAATGTCACCTATTCCAACCGGGAGCAGACCAGGCAGGCTGACGAGGTTCCCCTG AAGATCCTGGCCCATAATAACTTTGTAGGGCGTCTCATTGGCAAGGAAGGACGGAACCTGAAGAAGGTAG AGCAAGATACCGAGACAAAAATCACCATCTCCTCGTTGCAAGACCTTACCCTTTACAACCCTGAGAGGAC CATCACTGTGAAGGGGGCCATCGAGAATTGTTGCAGGGCCGAGCAGGAAATAATGAAGAAAGTTCGGGAG GCCTATGAGAATGATGTGGCTGCCATGAGCCTGCAGTCTCACCTGATCCCTGGCCTGAACCTGGCTGCTG TAGGTCTTTTCCCAGCTTCATCCAGCGCAGTCCCGCCGCCTCCCAGCAGCGTTACTGGGGCTGCTCCCTA TAGCTCCTTTATGCAGGCTCCCGAGCAGGAGATGGTGCAGGTGTTTATCCCCGCCCAGGCAGTGGGCGCC ATCATCGGCAAGAAGGGGCAGCACATCAAACAGCTCTCCCGGTTTGCCAGCGCCTCCATCAAGATTGCAC CACCCGAAACACCTGACTCCAAAGTTCGTATGGTTATCATCACTGGACCGCCAGAGGCCCAATTCAAGGC TCAGGGAAGAATCTATGGCAAACTCAAGGAGGAGAACTTCTTTGGTCCCAAGGAGGAAGTGAAGCTGGAG ACCCACATACGTGTGCCAGCATCAGCAGCTGGCCGGGTCATTGGCAAAGGTGGAAAAACGGTGAACGAGT TGCAGAATTTGACGGCAGCTGAGGTGGTAGTACCAAGAGACCAGACCCCTGATGAGAACGACCAGGTCAT CGTGAAAATCATCGGACATTTCTATGCCAGTCAGATGGCTCAACGGAAGATCCGAGACATCCTGGCCCAG GTTAAGCAGCAGCATCAGAAGGGACAGAGTAACCAGGCCCAGGCACGGAGGAAGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001160423 |
ORF Size | 1317 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001160423.1, NP_001153895.1 |
RefSeq Size | 8352 |
RefSeq ORF | 1317 |
Locus ID | 10642 |
Gene Summary | This gene encodes a member of the insulin-like growth factor 2 mRNA-binding protein family. The protein encoded by this gene contains four K homology domains and two RNA recognition motifs. It functions by binding to the mRNAs of certain genes, including insulin-like growth factor 2, beta-actin and beta-transducin repeat-containing protein, and regulating their translation. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009] Transcript Variant: This variant (2) lacks two alternate in-frame exons compared to variant 1. The resulting isoform (2) is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC228349 | IGF2BP1 (Myc-DDK-tagged)-Human insulin-like growth factor 2 mRNA binding protein 1 (IGF2BP1), transcript variant 2 |
USD 420.00 |
|
RG228349 | IGF2BP1 (GFP-tagged) - Human insulin-like growth factor 2 mRNA binding protein 1 (IGF2BP1), transcript variant 2 |
USD 460.00 |
|
RC228349L1 | Lenti ORF clone of Human insulin-like growth factor 2 mRNA binding protein 1 (IGF2BP1), transcript variant 2, Myc-DDK-tagged |
USD 768.00 |
|
RC228349L2 | Lenti ORF clone of Human insulin-like growth factor 2 mRNA binding protein 1 (IGF2BP1), transcript variant 2, mGFP tagged |
USD 620.00 |
|
RC228349L3 | Lenti ORF clone of Human insulin-like growth factor 2 mRNA binding protein 1 (IGF2BP1), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
RC228349L4 | Lenti ORF clone of Human insulin-like growth factor 2 mRNA binding protein 1 (IGF2BP1), transcript variant 2, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review