RRM2 (NM_001165931) Human Untagged Clone
CAT#: SC326997
RRM2 (untagged)-Human ribonucleotide reductase M2 (RRM2) transcript variant 1
"NM_001165931" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | RRM2 |
Synonyms | R2; RR2; RR2M |
Vector | pCMV6-XL6 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF sequence for NM_001165931 edited
ATGGGAAGGGTCGGAGGCATGGCACAGCCAATGGGAAGGGCCGGGGCACCAAAGCCAATG GGAAGGGCCGGGAGCGCGCGGCGCGGGAGATTTAAAGGCTGCTGGAGTGAGGGGTCGCCC GTGCACCCTGTCCCAGCCGTCCTGTCCTGGCTGCTCGCTCTGCTTCGCTGCGCCTCCACT ATGCTCTCCCTCCGTGTCCCGCTCGCGCCCATCACGGACCCGCAGCAGCTGCAGCTCTCG CCGCTGAAGGGGCTCAGCTTGGTCGACAAGGAGAACACGCCGCCGGCCCTGAGCGGGACC CGCGTCCTGGCCAGCAAGACCGCGAGGAGGATCTTCCAGGAGCCCACGGAGCCGAAAACT AAAGCAGCTGCCCCCGGCGTGGAGGATGAGCCGCTGCTGAGAGAAAACCCCCGCCGCTTT GTCATCTTCCCCATCGAGTACCATGATATCTGGCAGATGTATAAGAAGGCAGAGGCTTCC TTTTGGACCGCCGAGGAGGTGGACCTCTCCAAGGACATTCAGCACTGGGAATCCCTGAAA CCCGAGGAGAGATATTTTATATCCCATGTTCTGGCTTTCTTTGCAGCAAGCGATGGCATA GTAAATGAAAACTTGGTGGAGCGATTTAGCCAAGAAGTTCAGATTACAGAAGCCCGCTGT TTCTATGGCTTCCAAATTGCCATGGAAAACATACATTCTGAAATGTATAGTCTTCTTATT GACACTTACATAAAAGATCCCAAAGAAAGGGAATTTCTCTTCAATGCCATTGAAACGATG CCTTGTGTCAAGAAGAAGGCAGACTGGGCCTTGCGCTGGATTGGGGACAAAGAGGCTACC TATGGTGAACGTGTTGTAGCCTTTGCTGCAGTGGAAGGCATTTTCTTTTCCGGTTCTTTT GCGTCGATATTCTGGCTCAAGAAACGAGGACTGATGCCTGGCCTCACATTTTCTAATGAA CTTATTAGCAGAGATGAGGGTTTACACTGTGATTTTGCTTGCCTGATGTTCAAACACCTG GTACACAAACCATCGGAGGAGAGAGTAAGAGAAATAATTATCAATGCTGTTCGGATAGAA CAGGAGTTCCTCACTGAGGCCTTGCCTGTGAAGCTCATTGGGATGAATTGCACTCTAATG AAGCAATACATTGAGTTTGTGGCAGACAGACTTATGCTGGAACTGGGTTTTAGCAAGGTT TTCAGAGTAGAGAACCCATTTGACTTTATGGAGAATATTTCACTGGAAGGAAAGACTAAC TTCTTTGAGAAGAGAGTAGGCGAGTATCAGAGGATGGGAGTGATGTCAAGTCCAACAGAG AATTCTTTTACCTTGGATGCTGACTTCTAA |
Restriction Sites | NotI-NotI |
ACCN | NM_001165931 |
Insert Size | 3400 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001165931.1. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001165931.1, NP_001159403.1 |
RefSeq Size | 3452 bp |
RefSeq ORF | 1350 bp |
Locus ID | 6241 |
Cytogenetics | 2p25.1 |
Protein Families | Druggable Genome |
Protein Pathways | Glutathione metabolism, Metabolic pathways, p53 signaling pathway, Purine metabolism, Pyrimidine metabolism |
Gene Summary | 'This gene encodes one of two non-identical subunits for ribonucleotide reductase. This reductase catalyzes the formation of deoxyribonucleotides from ribonucleotides. Synthesis of the encoded protein (M2) is regulated in a cell-cycle dependent fashion. Transcription from this gene can initiate from alternative promoters, which results in two isoforms that differ in the lengths of their N-termini. Related pseudogenes have been identified on chromosomes 1 and X. [provided by RefSeq, Sep 2009]' Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC228362 | RRM2 (Myc-DDK-tagged)-Human ribonucleotide reductase M2 (RRM2), transcript variant 1 |
USD 420.00 |
|
RG228362 | RRM2 (GFP-tagged) - Human ribonucleotide reductase M2 (RRM2), transcript variant 1 |
USD 460.00 |
|
RC228362L1 | Lenti-ORF clone of RRM2 (Myc-DDK-tagged)-Human ribonucleotide reductase M2 (RRM2), transcript variant 1 |
USD 620.00 |
|
RC228362L2 | Lenti-ORF clone of RRM2 (mGFP-tagged)-Human ribonucleotide reductase M2 (RRM2), transcript variant 1 |
USD 768.00 |
|
RC228362L3 | Lenti-ORF clone of RRM2 (Myc-DDK-tagged)-Human ribonucleotide reductase M2 (RRM2), transcript variant 1 |
USD 620.00 |
|
RC228362L4 | Lenti-ORF clone of RRM2 (mGFP-tagged)-Human ribonucleotide reductase M2 (RRM2), transcript variant 1 |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review