ER81 (ETV1) (NM_001163147) Human Untagged Clone

CAT#: SC327004

ETV1 (untagged)-Human ets variant 1 (ETV1) transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ETV1
• Synonyms: ER81
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001163147, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGATGGATTTTATGACCAGCAAGTGCCTTACATGGTCACCAATAGTCAGCGTGGGAGAAATTGTAACG
  AGAAACCAACAAATGTCAGGAAAAGAAAATTCATTAACAGAGATCTGGCTCATGATTCAGAAGAACTCTT
  TCAAGATCTAAGTCAATTACAGGAAACATGGCTTGCAGAAGCTCAGGTACCTGACAATGATGAGCAGTTT
  GTACCAGACTATCAGGCTGAAAGTTTGGCTTTTCATGGCCTGCCACTGAAAATCAAGAAAGAACCCCACA
  GTCCATGTTCAGAAATCAGCTCTGCCTGCAGTCAAGAACAGCCCTTTAAATTCAGCTATGGAGAAAAGTG
  CCTGTACAATGTCAGTGCCTATGATCAGAAGCCACAAGTGGGAATGAGGCCCTCCAACCCCCCCACACCA
  TCCAGCACGCCAGTGTCCCCACTGCATCATGCATCTCCAAACTCAACTCATACACCGAAACCTGACCGGG
  CCTTCCCAGCTCACCTCCCTCCATCGCAGTCCATACCAGATAGCAGCTACCCCATGGACCACAGATTTCG
  CCGCCAGCTTTCTGAACCCTGTAACTCCTTTCCTCCTTTGCCGACGATGCCAAGGGAAGGACGTCCTATG
  TACCAACGCCAGATGTCTGAGCCAAACATCCCCTTCCCACCACAAGGCTTTAAGCAGGAGTACCACGACC
  CAGTGTATGAACACAACACCATGGTTGGCAGTGCGGCCAGCCAAAGCTTTCCCCCTCCTCTGATGATTAA
  ACAGGAACCCAGAGATTTTGCATATGACTCAGGCTGTATGTTTGAAAAGGGCCCCAGGCAGTTTTATGAT
  GACACCTGTGTTGTCCCAGAAAAATTCGATGGAGACATCAAACAAGAGCCAGGAATGTATCGGGAAGGAC
  CCACATACCAACGGCGAGGATCACTTCAGCTCTGGCAGTTTTTGGTAGCTCTTCTGGATGACCCTTCAAA
  TTCTCATTTTATTGCCTGGACTGGTCGAGGCATGGAATTTAAACTGATTGAGCCTGAAGAGGTGGCCCGA
  CGTTGGGGCATTCAGAAAAACAGGCCAGCTATGAACTATGATAAACTTAGCCGTTCACTCCGCTATTACT
  ATGAGAAAGGAATTATGCAAAAGGTGGCTGGAGAGAGATATGTCTACAAGTTTGTGTGTGATCCAGAAGC
  CCTTTTCTCCATGGCCTTTCCAGATAATCAGCGTCCACTGCTGAAGACAGACATGGAACGTCACATCAAC
  GAGGAGGACACAGTGCCTCTTTCTCACTTTGATGAGAGCATGGCCTACATGCCGGAAGGGGGCTGCTGCA
  ACCCCCACCCCTACAACGAAGGCTACGTGTATTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001163147
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001163147.1, NP_001156619.1
• RefSeq Size: 6558 bp
• RefSeq ORF: 1365 bp
• Locus ID: 2115
• Cytogenetics: 7p21.2
• Protein Families: ES Cell Differentiation/IPS, Transcription Factors
• Gene Summary: 'This gene encodes a member of the ETS (E twenty-six) family of transcription factors. The ETS proteins regulate many target genes that modulate biological processes like cell growth, angiogenesis, migration, proliferation and differentiation. All ETS proteins contain an ETS DNA-binding domain that binds to DNA sequences containing the consensus 5'-CGGA[AT]-3'. The protein encoded by this gene contains a conserved short acidic transactivation domain (TAD) in the N-terminal region, in addition to the ETS DNA-binding domain in the C-terminal region. This gene is involved in chromosomal translocations, which result in multiple fusion proteins including EWS-ETV1 in Ewing sarcoma and at least 10 ETV1 partners (see PMID: 19657377, Table 1) in prostate cancer. In addition to chromosomal rearrangement, this gene is overexpressed in prostate cancer, melanoma and gastrointestinal stromal tumor. Multiple alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2016]'
  Transcript Variant: This variant (2) lacks an alternate exon in the 5' UTR and an alternate in-frame exon in the 3' coding region, compared to variant 1. The resulting isoform (b) lacks an internal segment, compared to isoform a. This isoform contains the N-terminal TAD. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.