HMGCS2 (NM_001166107) Human Untagged Clone

CAT#: SC327023

HMGCS2 (untagged)-Human 3-hydroxy-3-methylglutaryl-Coenzyme A synthase 2 (mitochondrial) (HMGCS2) nuclear gene encoding mitochondrial protein transcript variant 2


  "NM_001166107" in other vectors (4)

Reconstitution Protocol

USD 780.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "HMGCS2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol HMGCS2
Synonyms 3-hydroxy-3-methylglutaryl-Coenzyme A synthase 2 (mitochondrial); hydroxymethylglutaryl-CoA synthase 2; OTTHUMP00000013928
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001166107, the custom clone sequence may differ by one or more nucleotides


ATGCAGCGTCTGTTGACTCCAGTGAAGCGCATTCTGCAACTGACAAGAGCGGTGCAGGAAACCTCCCTCA
CACCTGCTCGCCTGCTCCCAGTAGCCCACCAAAGGTTTTCTACAGCCTCTGCTGTCCCCCTGGCCAAAAC
AGATACTTGGCCAAAGGACGTGGGCATCCTGGCCCTGGAGGTCTACTTCCCAGCCCAATATGTGGACCAA
ACTGACCTGGAGAAGTATAACAATGTGGAAGCAGGAAAGTATACAGTGGGCTTGGGCCAGACCCGTATGG
GCTTCTGCTCAGTCCAAGAGGACATCAACTCCCTGTGCCTGACGGTGGTGCAACGGCTGATGGAGCGCAT
ACAGCTCCCATGGGACTCTGTGGGCAGGCTGGAAGTAGGCACTGAGACCATCATTGACAAGTCCAAAGCT
GTCAAAACAGTGCTCATGGAACTCTTCCAGGATTCAGGCAATACTGATATTGAGGGCATAGATACCACCA
ATGCCTGCTACGGTGGTACTGCCTCCCTCTTCAATGCTGCCAACTGGATGGAGTCCAGTTCCTGGGATGG
GCTGAGGGGAACCCATATGGAGAATGTGTATGACTTCTACAAACCAAATTTGGCCTCGGAGTACCCAATA
GTGGATGGGAAGCTTTCCATCCAGTGCTACTTGCGGGCCTTGGATCGATGTTACACATCATACCGTAAAA
AAATCCAGAATCAGTGGAAGCAAGCTGGCAGCGATCGACCCTTCACCCTTGACGATTTACAGTACATGAT
CTTTCATACACCCTTTTGCAAGATGGTCCAGAAGTCTCTGGCTCGCCTGATGTTCAATGACTTCCTGTCA
GCCAGCAGTGACACACAAACCAGCTTATATAAGGGGCTGGAGGCTTTCGGGGGGCTAAAGCTGGAAGACA
CCTACACCAACAAGGACCTGGATAAAGCACTTCTAAAGGCCTCTCAGGACATGTTCGACAAGAAAACCAA
GGCTTCCCTTTACCTCTCCACTCACAATGGGAACATGTACACCTCATCCCTGTACGGGTGCCTGGCCTCG
CTTCTGTCCCACCACTCTGCCCAAGAACTGGCTGGCTCCAGGATTGGTGCCTTCTCTTATGGCTCTGGTT
TAGCAGCAAGTTTCTTTTCATTTCGAGTATCCCAGGATGCTGCTCCAGGCTCTCCCCTGGACAAGTTGGT
GTCCAGCACATCAGACCTGCCAAAACGCCTAGCCTCCCGAAAGTGTGTGTCTCCTGAGGAGTTCACAGAA
ATAATGAACCAAAGAGAGCAATTCTACCATAAGGTGAATTTCTCCCCACCTGGTGACACAAACAGCCTTT
TCCCAGGTACTTGGTACCTGGAGCGAGTGGACGAGCAGCATCGCCGAAAGTATGCCCGGCGTCCCGTCTA
A


Restriction Sites SgfI-MluI     
ACCN NM_001166107
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001166107.1, NP_001159579.1
RefSeq Size 2351 bp
RefSeq ORF 1401 bp
Locus ID 3158
Cytogenetics 1p12
Protein Families Druggable Genome
Protein Pathways Butanoate metabolism, Metabolic pathways, PPAR signaling pathway, Synthesis and degradation of ketone bodies, Terpenoid backbone biosynthesis, Valine, leucine and isoleucine degradation
Gene Summary 'The protein encoded by this gene belongs to the HMG-CoA synthase family. It is a mitochondrial enzyme that catalyzes the first reaction of ketogenesis, a metabolic pathway that provides lipid-derived energy for various organs during times of carbohydrate deprivation, such as fasting. Mutations in this gene are associated with HMG-CoA synthase deficiency. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Oct 2009]'
Transcript Variant: This variant (2) is missing an in-frame coding exon compared to variant 1. This results in a shorter isoform (2) lacking an internal protein segment compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.