TMPRSS2 (NM_001135099) Human Untagged Clone
CAT#: SC327067
TMPRSS2 (untagged)-Human transmembrane protease serine 2 (TMPRSS2) transcript variant 1
"NM_001135099" in other vectors (6)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | TMPRSS2 |
Synonyms | PP9284; PRSS10 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001135099, the custom clone sequence may differ by one or more nucleotides
ATGCCCCCTGCCCCGCCCGGAGGTGAAAGCGGGTGTGAGGAGCGCGGCGCGGCAGGTCATATTGAACATT CCAGATACCTATCATTACTCGATGCTGTTGATAACAGCAAGATGGCTTTGAACTCAGGGTCACCACCAGC TATTGGACCTTACTATGAAAACCATGGATACCAACCGGAAAACCCCTATCCCGCACAGCCCACTGTGGTC CCCACTGTCTACGAGGTGCATCCGGCTCAGTACTACCCGTCCCCCGTGCCCCAGTACGCCCCGAGGGTCC TGACGCAGGCTTCCAACCCCGTCGTCTGCACGCAGCCCAAATCCCCATCCGGGACAGTGTGCACCTCAAA GACTAAGAAAGCACTGTGCATCACCTTGACCCTGGGGACCTTCCTCGTGGGAGCTGCGCTGGCCGCTGGC CTACTCTGGAAGTTCATGGGCAGCAAGTGCTCCAACTCTGGGATAGAGTGCGACTCCTCAGGTACCTGCA TCAACCCCTCTAACTGGTGTGATGGCGTGTCACACTGCCCCGGCGGGGAGGACGAGAATCGGTGTGTTCG CCTCTACGGACCAAACTTCATCCTTCAGGTGTACTCATCTCAGAGGAAGTCCTGGCACCCTGTGTGCCAA GACGACTGGAACGAGAACTACGGGCGGGCGGCCTGCAGGGACATGGGCTATAAGAATAATTTTTACTCTA GCCAAGGAATAGTGGATGACAGCGGATCCACCAGCTTTATGAAACTGAACACAAGTGCCGGCAATGTCGA TATCTATAAAAAACTGTACCACAGTGATGCCTGTTCTTCAAAAGCAGTGGTTTCTTTACGCTGTATAGCC TGCGGGGTCAACTTGAACTCAAGCCGCCAGAGCAGGATTGTGGGCGGCGAGAGCGCGCTCCCGGGGGCCT GGCCCTGGCAGGTCAGCCTGCACGTCCAGAACGTCCACGTGTGCGGAGGCTCCATCATCACCCCCGAGTG GATCGTGACAGCCGCCCACTGCGTGGAAAAACCTCTTAACAATCCATGGCATTGGACGGCATTTGCGGGG ATTTTGAGACAATCTTTCATGTTCTATGGAGCCGGATACCAAGTAGAAAAAGTGATTTCTCATCCAAATT ATGACTCCAAGACCAAGAACAATGACATTGCGCTGATGAAGCTGCAGAAGCCTCTGACTTTCAACGACCT AGTGAAACCAGTGTGTCTGCCCAACCCAGGCATGATGCTGCAGCCAGAACAGCTCTGCTGGATTTCCGGG TGGGGGGCCACCGAGGAGAAAGGGAAGACCTCAGAAGTGCTGAACGCTGCCAAGGTGCTTCTCATTGAGA CACAGAGATGCAACAGCAGATATGTCTATGACAACCTGATCACACCAGCCATGATCTGTGCCGGCTTCCT GCAGGGGAACGTCGATTCTTGCCAGGGTGACAGTGGAGGGCCTCTGGTCACTTCGAAGAACAATATCTGG TGGCTGATAGGGGATACAAGCTGGGGTTCTGGCTGTGCCAAAGCTTACAGACCAGGAGTGTACGGGAATG TGATGGTATTCACGGACTGGATTTATCGACAAATGAGGGCAGACGGCTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001135099 |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001135099.1, NP_001128571.1 |
RefSeq Size | 3250 bp |
RefSeq ORF | 1590 bp |
Locus ID | 7113 |
Cytogenetics | 21q22.3 |
Protein Families | Druggable Genome, Protease, Secreted Protein, Transmembrane |
Gene Summary | 'This gene encodes a protein that belongs to the serine protease family. The encoded protein contains a type II transmembrane domain, a receptor class A domain, a scavenger receptor cysteine-rich domain and a protease domain. Serine proteases are known to be involved in many physiological and pathological processes. This gene was demonstrated to be up-regulated by androgenic hormones in prostate cancer cells and down-regulated in androgen-independent prostate cancer tissue. The protease domain of this protein is thought to be cleaved and secreted into cell media after autocleavage. This protein also facilitates entry of viruses into host cells by proteolytically cleaving and activating viral envelope glycoproteins. Viruses found to use this protein for cell entry include Influenza virus and the human coronaviruses HCoV-229E, MERS-CoV, SARS-CoV and SARS-CoV-2 (COVID-19 virus). Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2020]' Transcript Variant: This variant (1) encodes the longer isoform (1). |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC228432 | TMPRSS2 (Myc-DDK-tagged)-Human transmembrane protease, serine 2 (TMPRSS2), transcript variant 1 |
USD 480.00 |
|
RG228432 | TMPRSS2 (GFP-tagged) - Human transmembrane protease, serine 2 (TMPRSS2), transcript variant 1 |
USD 530.00 |
|
RC228432L1 | Lenti-ORF clone of TMPRSS2 (Myc-DDK-tagged)-Human transmembrane protease, serine 2 (TMPRSS2), transcript variant 1 |
USD 680.00 |
|
RC228432L2 | Lenti-ORF clone of TMPRSS2 (mGFP-tagged)-Human transmembrane protease, serine 2 (TMPRSS2), transcript variant 1 |
USD 840.00 |
|
RC228432L3 | Lenti-ORF clone of TMPRSS2 (Myc-DDK-tagged)-Human transmembrane protease, serine 2 (TMPRSS2), transcript variant 1 |
USD 840.00 |
|
RC228432L4 | Lenti-ORF clone of TMPRSS2 (mGFP-tagged)-Human transmembrane protease, serine 2 (TMPRSS2), transcript variant 1 |
USD 680.00 |
{0} Product Review(s)
Be the first one to submit a review