FXYD6 (NM_001164831) Human Untagged Clone

CAT#: SC327357

FXYD6 (untagged)-Human FXYD domain containing ion transport regulator 6 (FXYD6) transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: FXYD6
• Synonyms: FXYD domain-containing ion transport regulator 6; FXYD domain containing ion transport regulator 6; phosphohippolin
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001164831, the custom clone sequence may differ by one or more nucleotides
  ATGGAGTTGGTGCTGGTCTTCCTCTGCAGCCTGCTGGCCCCCATGGTCCTGGCCAGTGCA
  GCTGAAAAGGAGAAGGAAATGGACCCTTTTCATTATGATTACCAGACCCTGAGGATTGGG
  GGACTGGTGTTCGCTGTGGTCCTCTTCTCGGTTGGGATCCTCCTTATCCTAAGTCGCAGG
  TGCAAGTGCAGTTTCAATCAGAAGCCCCGGGCCCCAGGAGATGAGGAAGCCCAGGTGGAG
  AACCTCATCACCGCCAATGCAACAGAGCCCCAGAAAGCAGAGAAC
  
• Restriction Sites: Please inquire
• ACCN: NM_001164831
• ORF Size: 288 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001164831.1, NP_001158303.1
• RefSeq Size: 1749
• RefSeq ORF: 288
• Locus ID: 53826
• Protein Families: Ion Channels: Other, Transmembrane
• Gene Summary: This gene encodes a member of the FXYD family of transmembrane proteins. This particular protein encodes phosphohippolin, which likely affects the activity of Na,K-ATPase. Multiple alternatively spliced transcript variants encoding the same protein have been described. Related pseudogenes have been identified on chromosomes 10 and X. Read-through transcripts have been observed between this locus and the downstream sodium/potassium-transporting ATPase subunit gamma (FXYD2, GeneID 486) locus. [provided by RefSeq, Feb 2011]
  Transcript Variant: This variant (2) differs in the 5' UTR, compared to variant 1. All variants encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.