Phospholipase A2 IIA (PLA2G2A) (NM_001161727) Human Untagged Clone

CAT#: SC327372

PLA2G2A (untagged)-Human phospholipase A2 group IIA (platelets synovial fluid) (PLA2G2A) transcript variant 2


  "NM_001161727" in other vectors (4)

Reconstitution Protocol

USD 420.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "PLA2G2A"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PLA2G2A
Synonyms MOM1; PLA2; PLA2B; PLA2L; PLA2S; PLAS1; sPLA2
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_001161727, the custom clone sequence may differ by one or more nucleotides
ATGAAGACCCTCCTACTGTTGGCAGTGATCATGATCTTTGGCCTACTGCAGGCCCATGGG
AATTTGGTGAATTTCCACAGAATGATCAAGTTGACGACAGGAAAGGAAGCCGCACTCAGT
TATGGCTTCTACGGCTGCCACTGTGGCGTGGGTGGCAGAGGATCCCCCAAGGATGCAACG
GATCGCTGCTGTGTCACTCATGACTGTTGCTACAAACGTCTGGAGAAACGTGGATGTGGC
ACCAAATTTCTGAGCTACAAGTTTAGCAACTCGGGGAGCAGAATCACCTGTGCAAAACAG
GACTCCTGCAGAAGTCAACTGTGTGAGTGTGATAAGGCTGCTGCCACCTGTTTTGCTAGA
AACAAGACGACCTACAATAAAAAGTACCAGTACTATTCCAATAAACACTGCAGAGGGAGC
ACCCCTCGTTGC
Restriction Sites Please inquire     
ACCN NM_001161727
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001161727.1, NP_001155199.1
RefSeq Size 986 bp
RefSeq ORF 435 bp
Locus ID 5320
Cytogenetics 1p36.13
Protein Families Druggable Genome, Transmembrane
Protein Pathways alpha-Linolenic acid metabolism, Arachidonic acid metabolism, Ether lipid metabolism, Fc epsilon RI signaling pathway, Glycerophospholipid metabolism, GnRH signaling pathway, Linoleic acid metabolism, Long-term depression, MAPK signaling pathway, Metabolic pathways, Vascular smooth muscle contraction, VEGF signaling pathway
Gene Summary 'The protein encoded by this gene is a member of the phospholipase A2 family (PLA2). PLA2s constitute a diverse family of enzymes with respect to sequence, function, localization, and divalent cation requirements. This gene product belongs to group II, which contains secreted form of PLA2, an extracellular enzyme that has a low molecular mass and requires calcium ions for catalysis. It catalyzes the hydrolysis of the sn-2 fatty acid acyl ester bond of phosphoglycerides, releasing free fatty acids and lysophospholipids, and thought to participate in the regulation of the phospholipid metabolism in biomembranes. Several alternatively spliced transcript variants with different 5' UTRs have been found for this gene.[provided by RefSeq, Sep 2009]'
Transcript Variant: This variant (2) uses an alternate acceptor splice site at one of the 5' non-coding exons compared to variant 1. Variants 1-4 encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.