RD3 (NM_001164688) Human Untagged Clone

CAT#: SC327388

RD3 (untagged)-Human retinal degeneration 3 (RD3) transcript variant 2


  "NM_001164688" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol RD3
Synonyms C1orf36; LCA12
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001164688, the custom clone sequence may differ by one or more nucleotides


ATGTCTCTCATCTCATGGCTTCGGTGGAACGAGGCCCCATCCCGGCTGTCCACCAGGAGCCCTGCTGAGA
TGGTGCTGGAGACGCTTATGATGGAGCTGACGGGGCAGATGCGAGAGGCTGAGAGGCAGCAGCGGGAGCG
CAGCAATGCGGTCAGAAAGGTCTGCACCGGTGTGGACTACAGCTGGCTGGCCAGCACACCCCGGTCCACC
TATGACCTCAGCCCCATTGAGCGGTTGCAGCTGGAAGATGTCTGCGTTAAGATCCACCCATCCTATTGTG
GGCCTGCTATCCTCAGGTTCCGGCAGCTGCTGGCGGAGCAGGAGCCCGAGGTGCAGGAGGTGTCCCAGCT
CTTCCGCTCGGTGCTGCAGGAGGTCCTGGAGAGGATGAAGCAGGAAGAGGAGGCCCACAAGCTGACGCGC
CAGTGGAGCCTGCGGCCCCGCGGCAGCCTGGCCACCTTCAAGACCCGCGCGCGCATCTCGCCCTTCGCCA
GCGACATCAGGACCATCTCCGAGGACGTGGAGCGGGACACACCGCCGCCACTGCGGTCCTGGAGCATGCC
CGAATTCCGGGCGCCCAAAGCCGACTGA


Restriction Sites SgfI-MluI     
ACCN NM_001164688
ORF Size 588 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001164688.1, NP_001158160.1
RefSeq Size 4287
RefSeq ORF 588
Locus ID 343035
Gene Summary This gene encodes a retinal protein that is associated with promyelocytic leukemia-gene product (PML) bodies in the nucleus. Mutations in this gene cause Leber congenital amaurosis type 12, a disease that results in retinal degeneration. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]
Transcript Variant: This variant (2) uses an alternate splice site in the 5' UTR compared to variant 1. Both variants 1 and 2 encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.