RD3 (NM_001164688) Human Untagged Clone
CAT#: SC327388
RD3 (untagged)-Human retinal degeneration 3 (RD3) transcript variant 2
"NM_001164688" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | RD3 |
Synonyms | C1orf36; LCA12 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001164688, the custom clone sequence may differ by one or more nucleotides
ATGTCTCTCATCTCATGGCTTCGGTGGAACGAGGCCCCATCCCGGCTGTCCACCAGGAGCCCTGCTGAGA TGGTGCTGGAGACGCTTATGATGGAGCTGACGGGGCAGATGCGAGAGGCTGAGAGGCAGCAGCGGGAGCG CAGCAATGCGGTCAGAAAGGTCTGCACCGGTGTGGACTACAGCTGGCTGGCCAGCACACCCCGGTCCACC TATGACCTCAGCCCCATTGAGCGGTTGCAGCTGGAAGATGTCTGCGTTAAGATCCACCCATCCTATTGTG GGCCTGCTATCCTCAGGTTCCGGCAGCTGCTGGCGGAGCAGGAGCCCGAGGTGCAGGAGGTGTCCCAGCT CTTCCGCTCGGTGCTGCAGGAGGTCCTGGAGAGGATGAAGCAGGAAGAGGAGGCCCACAAGCTGACGCGC CAGTGGAGCCTGCGGCCCCGCGGCAGCCTGGCCACCTTCAAGACCCGCGCGCGCATCTCGCCCTTCGCCA GCGACATCAGGACCATCTCCGAGGACGTGGAGCGGGACACACCGCCGCCACTGCGGTCCTGGAGCATGCC CGAATTCCGGGCGCCCAAAGCCGACTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001164688 |
ORF Size | 588 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001164688.1, NP_001158160.1 |
RefSeq Size | 4287 |
RefSeq ORF | 588 |
Locus ID | 343035 |
Gene Summary | This gene encodes a retinal protein that is associated with promyelocytic leukemia-gene product (PML) bodies in the nucleus. Mutations in this gene cause Leber congenital amaurosis type 12, a disease that results in retinal degeneration. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009] Transcript Variant: This variant (2) uses an alternate splice site in the 5' UTR compared to variant 1. Both variants 1 and 2 encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC228753 | RD3 (Myc-DDK-tagged)-Human retinal degeneration 3 (RD3), transcript variant 2 |
USD 420.00 |
|
RG228753 | RD3 (GFP-tagged) - Human retinal degeneration 3 (RD3), transcript variant 2 |
USD 460.00 |
|
RC228753L3 | Lenti ORF clone of Human retinal degeneration 3 (RD3), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
RC228753L4 | Lenti ORF clone of Human retinal degeneration 3 (RD3), transcript variant 2, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review