Secretogranin 3 (SCG3) (NM_001165257) Human Untagged Clone
CAT#: SC327405
SCG3 (untagged)-Human secretogranin III (SCG3) transcript variant 2
"NM_001165257" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | SCG3 |
Synonyms | SGIII |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_001165257, the custom clone sequence may differ by one or more nucleotides
ATGGCAGCAATTCAAGATGGTCTTGCTAAGGGAGAAAACGATGAAACAGTATCTAACACA TTAACCTTGACAAATGGCTTGGAAAGGAGAACTAAAACCTACAGTGAAGACAACTTTGAG GAACTCCAATATTTCCCAAATTTCTATGCGCTACTGAAAAGTATTGATTCAGAAAAAGAA GCAAAAGAGAAAGAAACACTGATTACTATCATGAAAACACTGATTGACTTTGTGAAGATG ATGGTGAAATATGGAACAATATCTCCAGAAGAAGGTGTTTCCTACCTTGAAAACTTGGAT GAAATGATTGCTCTTCAGACCAAAAACAAGCTAGAAAAAAATGCTACTGACAATATAAGC AAGCTTTTCCCAGCACCATCAGAGAAGAGTCATGAAGAAACAGACAGTACCAAGGAAGAA GCAGCTAAGATGGAAAAGGAATATGGAAGCTTGAAGGATTCCACAAAAGATGATAACTCC AACCCAGGAGGAAAGACAGATGAACCCAAAGGAAAAACAGAAGCCTATTTGGAAGCCATC AGAAAAAATATTGAATGGTTGAAGAAACATGACAAAAAGGGAAATAAAGAAGATTATGAC CTTTCAAAGATGAGAGACTTCATCAATAAACAAGCTGATGCTTATGTGGAGAAAGGCATC CTTGACAAGGAAGAAGCCGAGGCCATCAAGCGCATTTATAGCAGCCTG |
Restriction Sites | Please inquire |
ACCN | NM_001165257 |
ORF Size | 711 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001165257.1, NP_001158729.1 |
RefSeq Size | 3313 |
RefSeq ORF | 711 |
Locus ID | 29106 |
Protein Families | Druggable Genome, Secreted Protein |
Gene Summary | The protein encoded by this gene is a member of the chromogranin/secretogranin family of neuroendocrine secretory proteins. Granins may serve as precursors for biologically active peptides. Some granins have been shown to function as helper proteins in sorting and proteolytic processing of prohormones; however, the function of this protein is unknown. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009] Transcript Variant: This variant (2) lacks the alternate exon containing the translation intiation site compared to variant 1. The resulting isoform (2) is shorter at the N-terminus compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC228770 | SCG3 (Myc-DDK-tagged)-Human secretogranin III (SCG3), transcript variant 2 |
USD 490.00 |
|
RG228770 | SCG3 (GFP-tagged) - Human secretogranin III (SCG3), transcript variant 2 |
USD 540.00 |
|
RC228770L3 | Lenti-ORF clone of SCG3 (Myc-DDK-tagged)-Human secretogranin III (SCG3), transcript variant 2 |
USD 690.00 |
|
RC228770L4 | Lenti-ORF clone of SCG3 (mGFP-tagged)-Human secretogranin III (SCG3), transcript variant 2 |
USD 690.00 |
{0} Product Review(s)
Be the first one to submit a review