Secretogranin 3 (SCG3) (NM_001165257) Human Untagged Clone

CAT#: SC327405

SCG3 (untagged)-Human secretogranin III (SCG3) transcript variant 2


  "NM_001165257" in other vectors (4)

Reconstitution Protocol

USD 420.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "SCG3"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol SCG3
Synonyms SGIII
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_001165257, the custom clone sequence may differ by one or more nucleotides
ATGGCAGCAATTCAAGATGGTCTTGCTAAGGGAGAAAACGATGAAACAGTATCTAACACA
TTAACCTTGACAAATGGCTTGGAAAGGAGAACTAAAACCTACAGTGAAGACAACTTTGAG
GAACTCCAATATTTCCCAAATTTCTATGCGCTACTGAAAAGTATTGATTCAGAAAAAGAA
GCAAAAGAGAAAGAAACACTGATTACTATCATGAAAACACTGATTGACTTTGTGAAGATG
ATGGTGAAATATGGAACAATATCTCCAGAAGAAGGTGTTTCCTACCTTGAAAACTTGGAT
GAAATGATTGCTCTTCAGACCAAAAACAAGCTAGAAAAAAATGCTACTGACAATATAAGC
AAGCTTTTCCCAGCACCATCAGAGAAGAGTCATGAAGAAACAGACAGTACCAAGGAAGAA
GCAGCTAAGATGGAAAAGGAATATGGAAGCTTGAAGGATTCCACAAAAGATGATAACTCC
AACCCAGGAGGAAAGACAGATGAACCCAAAGGAAAAACAGAAGCCTATTTGGAAGCCATC
AGAAAAAATATTGAATGGTTGAAGAAACATGACAAAAAGGGAAATAAAGAAGATTATGAC
CTTTCAAAGATGAGAGACTTCATCAATAAACAAGCTGATGCTTATGTGGAGAAAGGCATC
CTTGACAAGGAAGAAGCCGAGGCCATCAAGCGCATTTATAGCAGCCTG
Restriction Sites Please inquire     
ACCN NM_001165257
ORF Size 711 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001165257.1, NP_001158729.1
RefSeq Size 3313
RefSeq ORF 711
Locus ID 29106
Protein Families Druggable Genome, Secreted Protein
Gene Summary The protein encoded by this gene is a member of the chromogranin/secretogranin family of neuroendocrine secretory proteins. Granins may serve as precursors for biologically active peptides. Some granins have been shown to function as helper proteins in sorting and proteolytic processing of prohormones; however, the function of this protein is unknown. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
Transcript Variant: This variant (2) lacks the alternate exon containing the translation intiation site compared to variant 1. The resulting isoform (2) is shorter at the N-terminus compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.