Syntaxin 1a (STX1A) (NM_001165903) Human Untagged Clone

CAT#: SC327419

STX1A (untagged)-Human syntaxin 1A (brain) (STX1A) transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: STX1A
• Synonyms: HPC-1; P35-1; STX1; SYN1A
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001165903, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAAGGACCGAACCCAGGAGCTCCGCACGGCCAAGGACAGCGATGATGATGATGATGTCGCTGTCACCG
  TGGACCGAGACCGCTTCATGGATGAGTTCTTTGAGCAGGTGGAGGAGATTCGAGGCTTCATTGACAAGAT
  CGCAGAGAACGTGGAGGAGGTGAAGCGGAAGCACAGTGCCATCCTGGCATCCCCCAACCCCGATGAGAAG
  ACGAAGGAGGAGCTGGAAGAACTCATGTCCGACATAAAGAAGACAGCAAACAAAGTTCGTTCCAAGTTAA
  AGAGCATCGAGCAGTCCATCGAGCAAGAGGAAGGCCTGAACCGCTCCTCCGCTGACCTGAGGATCCGGAA
  GACACAGCACTCCACGCTGTCCAGAAAGTTTGTGGAGGTCATGTCGGAGTACAACGCCACGCAGTCCGAC
  TACCGCGAGCGCTGCAAAGGCCGCATCCAGAGGCAGCTGGAGATCACCGGCAGGACCACGACCAGTGAGG
  AGCTGGAGGACATGCTGGAGAGTGGGAACCCCGCCATCTTTGCCTCTGGGATCATCATGGACTCCAGCAT
  CTCGAAGCAGGCTCTGAGCGAGATTGAGACGCGGCACAGTGAGATCATCAAGCTGGAGAACAGCATCCGT
  GAGCTACACGACATGTTCATGGACATGGCCATGCTCGTGGAGAGCCAGACTATGTGGAGAGGGCCGTGTC
  TGACACCAAGAAGGCCGTCAAGTACCAGAGCAAGGCGCGCCGGAAGAAAATCATGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001165903
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001165903.1, NP_001159375.1
• RefSeq Size: 2092 bp
• RefSeq ORF: 756 bp
• Locus ID: 6804
• Cytogenetics: 7q11.23
• Protein Families: Druggable Genome, Secreted Protein, Transmembrane
• Protein Pathways: SNARE interactions in vesicular transport
• Gene Summary: 'This gene encodes a member of the syntaxin superfamily. Syntaxins are nervous system-specific proteins implicated in the docking of synaptic vesicles with the presynaptic plasma membrane. Syntaxins possess a single C-terminal transmembrane domain, a SNARE [Soluble NSF (N-ethylmaleimide-sensitive fusion protein)-Attachment protein REceptor] domain (known as H3), and an N-terminal regulatory domain (Habc). Syntaxins bind synaptotagmin in a calcium-dependent fashion and interact with voltage dependent calcium and potassium channels via the C-terminal H3 domain. This gene product is a key molecule in ion channel regulation and synaptic exocytosis. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]'
  Transcript Variant: This variant (2) lacks an internal segment in the 3' coding region, as compared to variant 1. The resulting isoform (2) is shorter and has a distinct C-terminus, as compared to isoform 1.