SPSB2 (NM_001146316) Human Untagged Clone

CAT#: SC327422

SPSB2 (untagged)-Human splA/ryanodine receptor domain and SOCS box containing 2 (SPSB2) transcript variant 2


  "NM_001146316" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "SPSB2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol SPSB2
Synonyms GRCC9; SSB2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001146316, the custom clone sequence may differ by one or more nucleotides


ATGGGCCAGACAGCTCTGGCAGGGGGCAGCAGCAGCACCCCCACGCCACAGGCCCTGTACCCTGACCTCT
CCTGTCCCGAGGGCTTGGAAGAGCTGCTGTCTGCACCCCCTCCTGACCTGGGGGCCCAGCGGCGCCACGG
TTGGAACCCCAAAGACTGTTCAGAGAACATCGAGGTCAAGGAAGGAGGGTTGTACTTTGAGCGGCGGCCC
GTGGCCCAGAGCACTGATGGGGCCCGGGGTAAGAGGGGCTATTCAAGGGGCCTGCACGCCTGGGAGATCA
GCTGGCCCCTAGAGCAGAGGGGCACGCATGCCGTGGTGGGCGTGGCCACGGCCCTCGCCCCGCTGCAGAC
TGACCACTACGCGGCGCTGCTGGGCAGCAACAGCGAGTCGTGGGGCTGGGACATCGGGCGGGGGAAGCTG
TACCATCAGAGCAAGGGGCCCGGAGCCCCCCAGTATCCAGCGGGAACTCAGGGTGAGCAGCTGGAGGTGC
CAGAGAGACTGCTGGTGGTTCTGGACATGGAGGAGGGAACTCTGGGCTACGCTATTGGGGGCACCTACCT
GGGGCCAGCATTCCGCGGACTGAAGGGCAGGACCCTCTATCCGGCAGTAAGCGCTGTCTGGGGCCAGTGC
CAGGTCCGCATCCGCTACCTGGGCGAAAGGAGAGCGGAGCCACACTCCCTTCTGCACCTGAGCCGCCTGT
GTGTGCGCCACAACCTGGGGGATACCCGGCTCGGCCAGGTGTCTGCCCTGCCCTTGCCCCCTGCCATGAA
GCGCTACCTGCTCTACCAGTGA


Restriction Sites SgfI-MluI     
ACCN NM_001146316
ORF Size 792 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001146316.1, NP_001139788.1
RefSeq Size 1220
RefSeq ORF 792
Locus ID 84727
Protein Families Druggable Genome
Gene Summary This gene encodes a member of a subfamily of proteins containing a central SPRY (repeats in splA and RyR) domain and a C-terminal suppressor of cytokine signaling (SOCS) box. This protein plays a role in cell signaling. This gene is present in a gene-rich cluster on chromosome 12p13 in the vicinity of the CD4 antigen and triosephosphate isomerase genes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1, 2, and 4 encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.