SPSB2 (NM_001146316) Human Untagged Clone
CAT#: SC327422
SPSB2 (untagged)-Human splA/ryanodine receptor domain and SOCS box containing 2 (SPSB2) transcript variant 2
"NM_001146316" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | SPSB2 |
Synonyms | GRCC9; SSB2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001146316, the custom clone sequence may differ by one or more nucleotides
ATGGGCCAGACAGCTCTGGCAGGGGGCAGCAGCAGCACCCCCACGCCACAGGCCCTGTACCCTGACCTCT CCTGTCCCGAGGGCTTGGAAGAGCTGCTGTCTGCACCCCCTCCTGACCTGGGGGCCCAGCGGCGCCACGG TTGGAACCCCAAAGACTGTTCAGAGAACATCGAGGTCAAGGAAGGAGGGTTGTACTTTGAGCGGCGGCCC GTGGCCCAGAGCACTGATGGGGCCCGGGGTAAGAGGGGCTATTCAAGGGGCCTGCACGCCTGGGAGATCA GCTGGCCCCTAGAGCAGAGGGGCACGCATGCCGTGGTGGGCGTGGCCACGGCCCTCGCCCCGCTGCAGAC TGACCACTACGCGGCGCTGCTGGGCAGCAACAGCGAGTCGTGGGGCTGGGACATCGGGCGGGGGAAGCTG TACCATCAGAGCAAGGGGCCCGGAGCCCCCCAGTATCCAGCGGGAACTCAGGGTGAGCAGCTGGAGGTGC CAGAGAGACTGCTGGTGGTTCTGGACATGGAGGAGGGAACTCTGGGCTACGCTATTGGGGGCACCTACCT GGGGCCAGCATTCCGCGGACTGAAGGGCAGGACCCTCTATCCGGCAGTAAGCGCTGTCTGGGGCCAGTGC CAGGTCCGCATCCGCTACCTGGGCGAAAGGAGAGCGGAGCCACACTCCCTTCTGCACCTGAGCCGCCTGT GTGTGCGCCACAACCTGGGGGATACCCGGCTCGGCCAGGTGTCTGCCCTGCCCTTGCCCCCTGCCATGAA GCGCTACCTGCTCTACCAGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001146316 |
ORF Size | 792 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001146316.1, NP_001139788.1 |
RefSeq Size | 1220 |
RefSeq ORF | 792 |
Locus ID | 84727 |
Protein Families | Druggable Genome |
Gene Summary | This gene encodes a member of a subfamily of proteins containing a central SPRY (repeats in splA and RyR) domain and a C-terminal suppressor of cytokine signaling (SOCS) box. This protein plays a role in cell signaling. This gene is present in a gene-rich cluster on chromosome 12p13 in the vicinity of the CD4 antigen and triosephosphate isomerase genes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016] Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1, 2, and 4 encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC228787 | SPSB2 (Myc-DDK-tagged)-Human splA/ryanodine receptor domain and SOCS box containing 2 (SPSB2), transcript variant 2 |
USD 420.00 |
|
RG228787 | SPSB2 (GFP-tagged) - Human splA/ryanodine receptor domain and SOCS box containing 2 (SPSB2), transcript variant 2 |
USD 460.00 |
|
RC228787L3 | Lenti ORF clone of Human splA/ryanodine receptor domain and SOCS box containing 2 (SPSB2), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
RC228787L4 | Lenti ORF clone of Human splA/ryanodine receptor domain and SOCS box containing 2 (SPSB2), transcript variant 2, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review