NT5C3 (NT5C3A) (NM_001166118) Human Untagged Clone

CAT#: SC327437

NT5C3 (untagged)-Human 5'-nucleotidase cytosolic III (NT5C3) transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: NT5C3A
• Synonyms: cN-III; hUMP1; NT5C3; P5'N-1; P5N-1; p36; PN-I; POMP; PSN1; UMPH; UMPH1
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001166118, the custom clone sequence may differ by one or more nucleotides
  ATGCCAGAATTCCAGAAAAGTTCAGTTCGAATCAAGAACCCTACAAGAGTAGAAGAAATT
  ATCTGTGGTCTTATCAAAGGAGGAGCTGCCAAACTTCAGATAATAACGGACTTTGATATG
  ACACTCAGTAGATTTTCATATAAAGGGAAAAGATGCCCAACATGTCATAATATCATTGAC
  AACTGTAAGCTGGTTACAGATGAATGTAGAAAAAAGTTATTGCAACTAAAGGAAAAATAT
  TACGCTATTGAAGTTGATCCTGTTCTTACTGTAGAAGAGAAGTACCCTTATATGGTGGAA
  TGGTATACTAAATCACATGGTTTGCTTGTTCAGCAAGCTTTACCAAAAGCTAAACTTAAA
  GAAATTGTGGCAGAATCTGACGTTATGCTCAAAGAAGGATATGAGAATTTCTTTGATAAG
  CTCCAACAACATAGCATCCCCGTGTTCATATTTTCGGCTGGAATCGGCGATGTACTAGAG
  GAAGTTATTCGTCAAGCTGGTGTTTATCATCCCAATGTCAAAGTTGTGTCCAATTTTATG
  GATTTTGATGAAACTGGGGTGCTCAAAGGATTTAAAGGAGAACTAATTCATGTATTTAAC
  AAACATGATGGTGCCTTGAGGAATACAGAATATTTCAATCAACTAAAAGACAATAGTAAC
  ATAATTCTTCTGGGAGACTCCCAAGGAGACTTAAGAATGGCAGATGGAGTGGCCAATGTT
  GAGCACATTCTGAAAATTGGATATCTAAATGATAGAGTGGATGAGCTTTTAGAAAAGTAC
  ATGGACTCTTATGATATTGTTTTAGTACAAGATGAATCATTAGAAGTAGCCAACTCTATT
  TTACAGAAGATTCTA
  
• Restriction Sites: Please inquire
• ACCN: NM_001166118
• ORF Size: 1932 bp
• Insert Size: 1932
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001166118.1, NP_001159590.1
• RefSeq Size: 1932
• RefSeq ORF: 1932
• Locus ID: 51251
• Protein Families: Transmembrane
• Protein Pathways: Metabolic pathways, Nicotinate and nicotinamide metabolism, Purine metabolism, Pyrimidine metabolism
• Gene Summary: This gene encodes a member of the 5'-nucleotidase family of enzymes that catalyze the dephosphorylation of nucleoside 5'-monophosphates. The encoded protein is the type 1 isozyme of pyrimidine 5' nucleotidase and catalyzes the dephosphorylation of pyrimidine 5' monophosphates. Mutations in this gene are a cause of hemolytic anemia due to uridine 5-prime monophosphate hydrolase deficiency. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and pseudogenes of this gene are located on the long arm of chromosomes 3 and 4. [provided by RefSeq, Mar 2012]
  Transcript Variant: This variant (4) differs in the 5' UTR, includes two alternate internal exons, and initiates translation at a downstream, in-frame start codon, compared to variant 1. The encoded isoform (3) has a shorter N-terminus, compared to isoform 1. Variants 4 and 5 both encode the same isoform (3).