TBX20 (NM_001166220) Human Untagged Clone

CAT#: SC327450

TBX20 (untagged)-Human T-box 20 (TBX20) transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: TBX20
• Synonyms: ASD4
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001166220, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGAGTTCACGGCGTCCCCCAAGCCCCAACTCTCCTCTCGGGCCAACGCCTTCTCCATTGCCGCGCTCA
  TGTCGAGCGGCGGCTCTAAGGAGAAGGAGGCGACGGAGAACACAATCAAACCCCTGGAGCAATTTGTGGA
  GAAGTCGTCCTGTGCCCAGCCCCTGGGTGAGCTGACCAGCCTGGATGCTCATGGGGAGTTTGGTGGAGGC
  AGTGGCAGCAGCCCGTCCTCCTCCTCTCTGTGCACTGAGCCACTGATCCCCACCACCCCCATCATCCCCA
  GTGAGGAAATGGCCAAAATTGCCTGCAGCCTGGAGACCAAGGAGCTTTGGGACAAATTCCATGAGCTGGG
  CACCGAGATGATCATCACCAAGTCGGGCAGGAGGATGTTTCCAACCATCCGGGTGTCCTTTTCGGGGGTG
  GATCCTGAGGCCAAGTACATAGTCCTGATGGACATCGTCCCTGTGGACAACAAGAGGTACCGCTACGCCT
  ACCACCGGTCCTCCTGGCTGGTGGCTGGCAAGGCCGACCCGCCGTTGCCAGCCAGGCTCTATGTGCATCC
  AGATTCTCCTTTTACCGGTGAGCAACTACTCAAACAGATGGTGTCTTTTGAAAAGGTGAAACTCACCAAC
  AATGAACTGGATCAACATGGCCATATAATTTTGAACTCAATGCATAAGTACCAGCCAAGGGTGCACATCA
  TTAAGAAGAAAGACCACACAGCCTCATTGCTCAACCTGAAGTCTGAAGAATTTAGAACTTTCATCTTTCC
  AGAAACAGTTTTTACGGCAGTCACTGCCTACCAGAATCAACTGATAACGAAGCTGAAAATAGATAGCAAT
  CCTTTTGCCAAAGGATTCCGGGATTCCTCCAGGCTCACTGACATTGAGAGGTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001166220
• ORF Size: 894 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001166220.1, NP_001159692.1
• RefSeq Size: 1374
• RefSeq ORF: 894
• Locus ID: 57057
• Protein Families: Transcription Factors
• Gene Summary: This gene encodes a T-box family member. The T-box family members share a common DNA binding domain, termed the T-box, and they are transcription factors involved in the regulation of developmental processes. This gene is essential for heart development. Mutations in this gene are associated with diverse cardiac pathologies, including defects in septation, valvulogenesis and cardiomyopathy. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
  Transcript Variant: This variant (2) has an alternate 3' end, as compared to variant 1. The resulting isoform (2) is C-terminal truncated, as compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.