NEK6 (NM_001166168) Human Untagged Clone

CAT#: SC327453

NEK6 (untagged)-Human NIMA (never in mitosis gene a)-related kinase 6 (NEK6) transcript variant 5


  "NM_001166168" in other vectors (4)

Reconstitution Protocol

USD 660.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "NEK6"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol NEK6
Synonyms SID6-1512
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001166168, the custom clone sequence may differ by one or more nucleotides


ATGGCAGGACAGCCCGGCCACATGCCCCATGGAGGGAGTTCCAACAACCTCTGCCACACCCTGGGGCCTG
TGCATCCTCCTGACCCACAGAGGCATCCCAACACGCTGTCTTTTCGCTGCTCGCTGGCGGACTTCCAGAT
CGAAAAGAAGATAGGCCGAGGACAGTTCAGCGAGGTGTACAAGGCCACCTGCCTGCTGGACAGGAAGACA
GTGGCTCTGAAGAAGGTGCAGATCTTTGAGATGATGGACGCCAAGGCGAGGCAGGACTGTGTCAAGGAGA
TCGGCCTCTTGAAGCAACTGAACCACCCAAATATCATCAAGTATTTGGACTCGTTTATCGAAGACAACGA
GCTGAACATTGTGCTGGAGTTGGCTGACGCAGGGGACCTCTCGCAGATGATCAAGTACTTTAAGAAGCAG
AAGCGGCTCATCCCGGAGAGGACAGTATGGAAGTACTTTGTGCAGCTGTGCAGCGCCGTGGAGCACATGC
ATTCACGCCGGGTGATGCACCGAGACATCAAGCCTGCCAACGTGTTCATCACAGCCACGGGCGTCGTGAA
GCTCGGTGACCTTGGTCTGGGCCGCTTCTTCAGCTCTGAGACCACCGCAGCCCACTCCCTAGTGGGGACG
CCCTACTACATGTCACCGGAGAGGATCCATGAGAACGGCTACAACTTCAAGTCCGACATCTGGTCCCTGG
GCTGTCTGCTGTACGAGATGGCAGCCCTCCAGAGCCCCTTCTATGGAGATAAGATGAATCTCTTCTCCCT
GTGCCAGAAGATCGAGCAGTGTGACTACCCCCCACTCCCCGGGGAGCACTACTCCGAGAAGTTACGAGAA
CTGGTCAGCATGTGCATCTGCCCTGACCCCCACCAGAGACCTGACATCGGATACGTGCACCAGGTGGCCA
AGCAGATGCACATCTGGATGTCCAGCACCTGA


Restriction Sites SgfI-MluI     
ACCN NM_001166168
ORF Size 942 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001166168.1, NP_001159640.1
RefSeq Size 2587
RefSeq ORF 942
Locus ID 10783
Protein Families Druggable Genome, Protein Kinase
Gene Summary The protein encoded by this gene is a kinase required for progression through the metaphase portion of mitosis. Inhibition of the encoded protein can lead to apoptosis. This protein also can enhance tumorigenesis by suppressing tumor cell senescence. Several transcript variants encoding a few different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Transcript Variant: This variant (5) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at a downstream start codon, compared to variant 1. The encoded isoform (2) is shorter than isoform 1. Variants 2, 5 and 6 encode the same isoform (2).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.