PAF Receptor (PTAFR) (NM_001164721) Human Untagged Clone
CAT#: SC327465
PTAFR (untagged)-Human platelet-activating factor receptor (PTAFR) transcript variant 1
"NM_001164721" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | PTAFR |
Synonyms | PAFR |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001164721, the custom clone sequence may differ by one or more nucleotides
ATGGAGCCACATGACTCCTCCCACATGGACTCTGAGTTCCGATACACTCTCTTCCCGATTGTTTACAGCA TCATCTTTGTGCTCGGGGTCATTGCTAATGGCTACGTGCTGTGGGTCTTTGCCCGCCTGTACCCTTGCAA GAAATTCAATGAGATAAAGATCTTCATGGTGAACCTCACCATGGCGGACATGCTCTTCTTGATCACCCTG CCACTTTGGATTGTCTACTACCAAAACCAGGGCAACTGGATACTCCCCAAATTCCTGTGCAACGTGGCTG GCTGCCTTTTCTTCATCAACACCTACTGCTCTGTGGCCTTCCTGGGCGTCATCACTTATAACCGCTTCCA GGCAGTAACTCGGCCCATCAAGACTGCTCAGGCCAACACCCGCAAGCGTGGCATCTCTTTGTCCTTGGTC ATCTGGGTGGCCATTGTGGGAGCTGCATCCTACTTCCTCATCCTGGACTCCACCAACACAGTGCCCGACA GTGCTGGCTCAGGCAACGTCACTCGCTGCTTTGAGCATTACGAGAAGGGCAGCGTGCCAGTCCTCATCAT CCACATCTTCATCGTGTTCAGCTTCTTCCTGGTCTTCCTCATCATCCTCTTCTGCAACCTGGTCATCATC CGTACCTTGCTCATGCAGCCGGTGCAGCAGCAGCGCAACGCTGAAGTCAAGCGCCGGGCGCTGTGGATGG TGTGCACGGTCTTGGCGGTGTTCATCATCTGCTTCGTGCCCCACCACGTGGTGCAGCTGCCCTGGACCCT TGCTGAGCTGGGCTTCCAGGACAGCAAATTCCACCAGGCCATTAATGATGCACATCAGGTCACCCTCTGC CTCCTTAGCACCAACTGTGTCTTAGACCCTGTTATCTACTGTTTCCTCACCAAGAAGTTCCGCAAGCACC TCACCGAAAAGTTCTACAGCATGCGCAGTAGCCGGAAATGCTCCCGGGCCACCACGGATACGGTCACTGA AGTGGTTGTGCCATTCAACCAGATCCCTGGCAATTCCCTCAAAAATTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001164721 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001164721.1, NP_001158193.1 |
RefSeq Size | 4191 bp |
RefSeq ORF | 1029 bp |
Locus ID | 5724 |
Cytogenetics | 1p35.3 |
Protein Families | Druggable Genome, GPCR, Transmembrane |
Protein Pathways | Calcium signaling pathway, Neuroactive ligand-receptor interaction |
Gene Summary | 'This gene encodes a seven-transmembrane G-protein-coupled receptor for platelet-activating factor (PAF) that localizes to lipid rafts and/or caveolae in the cell membrane. PAF (1-0-alkyl-2-acetyl-sn-glycero-3-phosphorylcholine) is a phospholipid that plays a significant role in oncogenic transformation, tumor growth, angiogenesis, metastasis, and pro-inflammatory processes. Binding of PAF to the PAF-receptor (PAFR) stimulates numerous signal transduction pathways including phospholipase C, D, A2, mitogen-activated protein kinases (MAPKs), and the phosphatidylinositol-calcium second messenger system. Following PAFR activation, cells become rapidly desensitized and this refractory state is dependent on PAFR phosphorylation, internalization, and down-regulation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]' Transcript Variant: This variant (1) is composed of three exons. Variants 1-4 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC228830 | PTAFR (Myc-DDK-tagged)-Human platelet-activating factor receptor (PTAFR), transcript variant 1 |
USD 420.00 |
|
RG228830 | PTAFR (GFP-tagged) - Human platelet-activating factor receptor (PTAFR), transcript variant 1 |
USD 460.00 |
|
RC228830L1 | Lenti ORF clone of Human platelet-activating factor receptor (PTAFR), transcript variant 1, Myc-DDK-tagged |
USD 768.00 |
|
RC228830L2 | Lenti ORF clone of Human platelet-activating factor receptor (PTAFR), transcript variant 1, mGFP tagged |
USD 620.00 |
|
RC228830L3 | Lenti ORF clone of Human platelet-activating factor receptor (PTAFR), transcript variant 1, Myc-DDK-tagged |
USD 620.00 |
|
RC228830L4 | Lenti ORF clone of Human platelet-activating factor receptor (PTAFR), transcript variant 1, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review