NDUFV1 (NM_001166102) Human Untagged Clone

CAT#: SC327539

NDUFV1 (untagged)-Human NADH dehydrogenase (ubiquinone) flavoprotein 1 51kDa (NDUFV1) nuclear gene encoding mitochondrial protein transcript variant 2


  "NM_001166102" in other vectors (4)

Reconstitution Protocol

USD 760.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "NDUFV1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol NDUFV1
Synonyms CI-51K; CI51KD; MC1DN4; UQOR1
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_001166102, the custom clone sequence may differ by one or more nucleotides
ATGCTGGCAACACGGCGGCTGCTCGGCTGGTCGCTTCCCGCGCGGACAGCACCCAAGAAA
ACCTCATTTGGCTCGCTGAAGGATGAAGACCGGATTTTCACCAACCTGTACGGCCGCCAT
GACTGGAGGCTGAAAGGTTCCCTGAGTCGAGGTGACTGGTACAAGACAAAGGAGATCCTG
CTGAAGGGGCCCGACTGGATCCTGGGCGAGATCAAGACATCGGGTTTGAGGGGCCGTGGA
GGCGCTGGCTTCCCCACTGGCCTCAAGTGGAGCTTCATGAATAAGCCCTCAGATGGCAGG
CCCAAGTATCTGGTGGTGAACGCAGACGAGGGGGAGCCGGGCACCTGCAAGGACCGGGAG
ATCTTACGCCATGATCCTCACAAGCTGCTGGAAGGCTGCCTGGTGGGGGGCCGGGCCATG
GGCGCCCGCGCTGCCTATATCTACATCCGAGGGGAATTCTACAATGAGGCCTCCAATCTG
CAGGTGGCCATCCGAGAGGCCTATGAGGCAGGTCTGATTGGCAAGAATGCTTGTGGCTCT
GGCTATGATTTTGACGTGTTTGTGGTGCGCGGGGCTGGGGCCTACATCTGTGGAGAGGAG
ACAGCGCTCATCGAGTCCATTGAGGGCAAGCAGGGCAAGCCCCGCCTGAAGCCCCCCTTC
CCCGCAGACGTGGGAGTGTTTGGCTGCCCCACAACTGTGGCCAACGTGGAGACAGTGGCA
GTGTCCCCCACAATCTGCCGCCGTGGAGGTACCTGGTTTGCTGGCTTTGGCAGAGAACGC
AACTCAGGCACCAAACTATTCAACATCTCTGGCCATGTCAACCACCCTTGCACTGTGGAG
GAGGAGATGTCTGTGCCCTTGAAAGAACTGATTGAGAAGCATGCTGGGGGTGTCACGGGC
GGCTGGGACAACCTCCTTGCTGTGATCCCTGGCGGCTCGTCTACCCCACTGATCCCCAAG
TCTGTGTGTGAGACGGTGCTGATGGACTTCGATGCGCTGGTGCAGGCACAGACAGGCCTG
GGCACAGCTGCGGTGATCGTCATGGACCGCTCGACGGACATCGTGAAAGCCATCGCCCGC
CTCATTGAGTTCTATAAGCACGAGAGCTGTGGCCAGTGTACCCCATGCCGTGAGGGTGTG
GACTGGATGAACAAGGTGATGGCACGTTTCGTGAGGGGGGATGCCCGGCCGGCCGAGATC
GACTCCCTGTGGGAGATCAGCAAGCAGATAGAAGGCCATACGATTTGTGCTCTGGGTGAC
GGGGCCGCCTGGCCTGTGCAGGGTCTGATCCGCCACTTTCGGCCGGAGCTCGAGGAGCGG
ATGCAGCGGTTTGCCCAGCAGCATCAGGCCCGGCAGGCTGCCTCT
Restriction Sites Please inquire     
ACCN NM_001166102
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001166102.1, NP_001159574.1
RefSeq Size 1604 bp
RefSeq ORF 1368 bp
Locus ID 4723
Cytogenetics 11q13.2
Protein Families Druggable Genome
Protein Pathways Alzheimer's disease, Huntington's disease, Metabolic pathways, Oxidative phosphorylation, Parkinson's disease
Gene Summary 'The mitochondrial respiratory chain provides energy to cells via oxidative phosphorylation and consists of four membrane-bound electron-transporting protein complexes (I-IV) and an ATP synthase (complex V). This gene encodes a 51 kDa subunit of the NADH:ubiquinone oxidoreductase complex I; a large complex with at least 45 nuclear and mitochondrial encoded subunits that liberates electrons from NADH and channels them to ubiquinone. This subunit carries the NADH-binding site as well as flavin mononucleotide (FMN)- and Fe-S-biding sites. Defects in complex I are a common cause of mitochondrial dysfunction; a syndrome that occurs in approximately 1 in 10,000 live births. Mitochondrial complex I deficiency is linked to myopathies, encephalomyopathies, and neurodegenerative disorders such as Parkinson's disease and Leigh syndrome. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Oct 2009]'
Transcript Variant: This variant (2) uses an alternate in-frame splice site in the 5' coding region, compared to variant 1, resulting in a shorter protein (isoform 2), compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.