PAK2 (NM_002577) Human Untagged Clone
CAT#: SC327574
PAK2 (untagged)-Human p21 protein (Cdc42/Rac)-activated kinase 2 (PAK2)
"NM_002577" in other vectors (5)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | PAK2 |
Synonyms | PAK65; PAKgamma |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF sequence for NM_002577 edited
AGATCTGGTACCGATGTCTGATAACGGAGAACTGGAAGATAAGCCTCCAGCACCTCCTGT GCGAATGAGCAGCACCATCTTTAGCACTGGAGGCAAAGACCCTTTGTCAGCCAATCACAG TTTGAAACCTTTGCCCTCTGTTCCAGAAGAGAAAAAGCCCAGGCATAAAATCATCTCCAT ATTCTCAGGCACAGAGAAAGGAAGTAAAAAGAAAGAAAAGGAACGGCCAGAAATTTCTCC TCCATCTGATTTTGAGCACACCATCCATGTTGGCTTTGATGCTGTTACTGGAGAATTCAC TGGCATGCCAGAACAGTGGGCTCGATTACTACAGACCTCCAATATCACCAAACTAGAGCA AAAGAAGAATCCTCAGGCTGTGCTGGATGTCCTAAAGTTCTACGACTCCAACACAGTGAA GCAGAAATATCTGAGCTTTACTCCTCCTGAGAAAGATGGCTTTCCTTCTGGAACACCAGC ACTGAATGCCAAGGGAACAGAAGCACCCGCAGTAGTGACAGAGGAGGAGGATGATGATGA AGAGACTGCTCCTCCCGTTATTGCCCCGCGACCGGATCATACGAAATCAATTTACACACG GTCTGTAATTGACCCTGTTCCTGCACCAGTTGGTGATTCACATGTTGATGGTGCTGCCAA GTCTTTAGACAAACAGAAAAAGAAGACTAAGATGACAGATGAAGAGATTATGGAGAAATT AAGAACTATCGTGAGCATAGGTGACCCTAAGAAAAAATATACAAGATATGAAAAAATTGG ACAAGGGGCTTCTGGTACAGTTTTCACTGCTACTGACGTTGCACTGGGACAGGAGGTTGC TATCAAACAAATTAATTTACAGAAACAGCCAAAGAAGGAACTGATCATTAACGAGATTCT GGTGATGAAAGAATTGAAAAATCCCAACATCGTTAACTTTTTGGACAGTTACCTGGTAGG AGATGAATTGTTTGTGGTCATGGAATACCTTGCTGGGGGGTCACTCACTGATGTGGTAAC AGAAACGTGCATGGATGAAGCACAGATTGCTGCTGTATGCAGAGAGTGTTTACAGGCATT GGAGTTTTTACATGCTAATCAAGTGATCCACAGAGACATCAAAAGTGACAATGTACTTTT GGGAATGGAAGGATCTGTTAAGCTCACTGACTTTGGTTTCTGTGCCCAGATCACCCCTGA GCAGAGCAAACGCAGTACCATGGTCGGAACGCCATACTGGATGGCACCAGAGGTGGTTAC ACGGAAAGCTTATGGCCCTAAAGTCGACATATGGTCTCTGGGTATCATGGCTATTGAGAT GGTAGAAGGAGAGCCTCCATACCTCAATGAAAATCCCTTGAGGGCCTTGTACCTAATAGC AACTAATGGAACCCCAGAACTTCAGAATCCAGAGAAACTTTCCCCAATATTTCGGGATTT CTTAAATCGATGTTTGGAAATGGATGTGGAAAAAAGGGGTTCAGCCAAAGAATTATTACA GCATCCTTTCCTGAAACTGGCCAAACCGTTATCTAGCTTGACACCACTGATCATGGCAGC TAAAGAAGCAATGAAGAGTAACCGTTAACATCACTGCTGTGGCCTCATACTCTTTTT |
Restriction Sites | Please inquire |
ACCN | NM_002577 |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This clone may be unstable or toxic at high copy number in common E. coli strain. We recommend using a lower copy number E. coli strain, such as CopyCutter strain (http://www.epibio.com/item.asp?ID=435) for transformation and plasmid preparation. Please be aware that the DNA yield could be low. Additional aliquots of this clone can be ordered from OriGene. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_002577.4, NP_002568.2 |
RefSeq Size | 6139 bp |
RefSeq ORF | 1575 bp |
Locus ID | 5062 |
Cytogenetics | 3q29 |
Protein Families | Druggable Genome, Protein Kinase |
Protein Pathways | Axon guidance, ErbB signaling pathway, Focal adhesion, MAPK signaling pathway, Regulation of actin cytoskeleton, Renal cell carcinoma, T cell receptor signaling pathway |
Gene Summary | 'The p21 activated kinases (PAK) are critical effectors that link Rho GTPases to cytoskeleton reorganization and nuclear signaling. The PAK proteins are a family of serine/threonine kinases that serve as targets for the small GTP binding proteins, CDC42 and RAC1, and have been implicated in a wide range of biological activities. The protein encoded by this gene is activated by proteolytic cleavage during caspase-mediated apoptosis, and may play a role in regulating the apoptotic events in the dying cell. [provided by RefSeq, Jul 2008]' |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
SC315439 | PAK2 (untagged)-Human p21 protein (Cdc42/Rac)-activated kinase 2 (PAK2) |
USD 760.00 |
|
RC210165 | PAK2 (Myc-DDK-tagged)-Human p21 protein (Cdc42/Rac)-activated kinase 2 (PAK2). Note: ORF is codon optimized |
USD 420.00 |
|
RG210165 | PAK2 (GFP-tagged) - Human p21 protein (Cdc42/Rac)-activated kinase 2 (PAK2). Note: ORF is codon optimized |
USD 460.00 |
|
RC210165L3 | Lenti-ORF clone of PAK2 (Myc-DDK-tagged)-Human p21 protein (Cdc42/Rac)-activated kinase 2 (PAK2). Note: ORF is codon optimized |
USD 620.00 |
|
RC210165L4 | Lenti-ORF clone of PAK2 (mGFP-tagged)-Human p21 protein (Cdc42/Rac)-activated kinase 2 (PAK2). Note: ORF is codon optimized |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review