HOPX (NM_032495) Human Untagged Clone

CAT#: SC327724

HOPX (untagged)-Human HOP homeobox (HOPX) transcript variant 1


  "NM_032495" in other vectors (7)

Reconstitution Protocol

USD 420.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "HOPX"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol HOPX
Synonyms CAMEO; HOD; HOP; LAGY; NECC1; OB1; SMAP31; TOTO
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_032495, the custom clone sequence may differ by one or more nucleotides
ATGCTCATTTTCCTGGGCTGTTACAGAAGAAGACTGGAAGAGCGCGCAGGGACCATGTCG
GCGGAGACCGCGAGCGGCCCCACAGAGGACCAGGTGGAAATCCTGGAGTACAACTTCAAC
AAGGTCGACAAGCACCCGGATTCCACCACGCTGTGCCTCATCGCGGCCGAGGCAGGCCTT
TCCGAGGAGGAGACCCAGAAATGGTTTAAGCAGCGCCTGGCAAAGTGGCGGCGCTCAGAA
GGCCTGCCCTCAGAGTGCAGATCCGTCACAGAC
Restriction Sites Please inquire     
ACCN NM_032495
ORF Size 276 bp
Insert Size 1552
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_032495.5, NP_115884.4
RefSeq Size 1552
RefSeq ORF 276
Locus ID 84525
Domains homeobox
Protein Families Transcription Factors
Gene Summary The protein encoded by this gene is a homeodomain protein that lacks certain conserved residues required for DNA binding. It was reported that choriocarcinoma cell lines and tissues failed to express this gene, which suggested the possible involvement of this gene in malignant conversion of placental trophoblasts. Studies in mice suggest that this protein may interact with serum response factor (SRF) and modulate SRF-dependent cardiac-specific gene expression and cardiac development. Multiple alternatively spliced transcript variants have been identified for this gene. [provided by RefSeq, Feb 2009]
Transcript Variant: This variant (1) encodes isoform a.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.