HOPX (NM_032495) Human Untagged Clone
CAT#: SC327724
HOPX (untagged)-Human HOP homeobox (HOPX) transcript variant 1
"NM_032495" in other vectors (7)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | HOPX |
Synonyms | CAMEO; HOD; HOP; LAGY; NECC1; OB1; SMAP31; TOTO |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_032495, the custom clone sequence may differ by one or more nucleotides
ATGCTCATTTTCCTGGGCTGTTACAGAAGAAGACTGGAAGAGCGCGCAGGGACCATGTCG GCGGAGACCGCGAGCGGCCCCACAGAGGACCAGGTGGAAATCCTGGAGTACAACTTCAAC AAGGTCGACAAGCACCCGGATTCCACCACGCTGTGCCTCATCGCGGCCGAGGCAGGCCTT TCCGAGGAGGAGACCCAGAAATGGTTTAAGCAGCGCCTGGCAAAGTGGCGGCGCTCAGAA GGCCTGCCCTCAGAGTGCAGATCCGTCACAGAC |
Restriction Sites | Please inquire |
ACCN | NM_032495 |
ORF Size | 276 bp |
Insert Size | 1552 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_032495.5, NP_115884.4 |
RefSeq Size | 1552 |
RefSeq ORF | 276 |
Locus ID | 84525 |
Domains | homeobox |
Protein Families | Transcription Factors |
Gene Summary | The protein encoded by this gene is a homeodomain protein that lacks certain conserved residues required for DNA binding. It was reported that choriocarcinoma cell lines and tissues failed to express this gene, which suggested the possible involvement of this gene in malignant conversion of placental trophoblasts. Studies in mice suggest that this protein may interact with serum response factor (SRF) and modulate SRF-dependent cardiac-specific gene expression and cardiac development. Multiple alternatively spliced transcript variants have been identified for this gene. [provided by RefSeq, Feb 2009] Transcript Variant: This variant (1) encodes isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
SC104614 | HOPX (untagged)-Human HOP homeobox (HOPX), transcript variant 1 |
USD 420.00 |
|
RC222859 | HOPX (Myc-DDK-tagged)-Human HOP homeobox (HOPX), transcript variant 1 |
USD 420.00 |
|
RG222859 | HOPX (GFP-tagged) - Human HOP homeobox (HOPX), transcript variant 1 |
USD 460.00 |
|
RC222859L1 | Lenti ORF clone of Human HOP homeobox (HOPX), transcript variant 1, Myc-DDK-tagged |
USD 620.00 |
|
RC222859L2 | Lenti ORF clone of Human HOP homeobox (HOPX), transcript variant 1, mGFP tagged |
USD 620.00 |
|
RC222859L3 | Lenti ORF clone of Human HOP homeobox (HOPX), transcript variant 1, Myc-DDK-tagged |
USD 620.00 |
|
RC222859L4 | Lenti ORF clone of Human HOP homeobox (HOPX), transcript variant 1, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review