TIMM8B (NM_012459) Human Untagged Clone

CAT#: SC327725

TIMM8B (untagged)-Human translocase of inner mitochondrial membrane 8 homolog B (yeast) (TIMM8B) nuclear gene encoding mitochondrial protein transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: TIMM8B
• Synonyms: DDP2; TIM8B
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_012459, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCGCAAACACAGCTGTCGGAAGGTGGCGAGCCTGAGGCGAACAATGGCGGAGCTGGGCGAAGCCGATG
  AAGCGGAGTTGCAGCGCCTGGTGGCCGCCGAGCAGCAGAAGGCGCAGTTTACTGCACAGGTGCATCACTT
  CATGGAGTTATGTTGGGATAAATGTGTGGAGAAGCCAGGGAATCGCCTAGACTCTCGCACTGAAAATTGT
  CTCTCCAGCTGTGTAGACCGCTTCATTGACACCACTCTTGCCATCACCAGTCGGTTTGCCCAGATTGTAC
  AGAAAGGAGGGCAGTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_012459
• ORF Size: 297 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_012459.2, NP_036591.2
• RefSeq Size: 823
• RefSeq ORF: 297
• Locus ID: 26521
• Domains: zf-Tim10_DDP
• Gene Summary: This gene encodes a member of a well-conserved family of proteins with similarity to yeast Tim mitochondrial import proteins. This gene is encoded by a nuclear gene and is transported into the intermembrane space of the mitochondrion. When formed into complexes, these proteins guide membrane-spanning proteins across the mitochondrial intermembrane space before they are added into the mitochondrial inner membrane. This gene is adjacent to succinate dehydrogenase, subunit D (SDHD), in which mutations have been found in affected members of families with hereditary paraganglioma. [provided by RefSeq, Aug 2009]
  Transcript Variant: This variant (1) encodes the functional protein. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. CCDS Note: The coding region has been updated to start at a downstream in-frame start codon that is supported by conservation data.