BAX (NM_138764) Human Untagged Clone

CAT#: SC327749

BAX (untagged)-Human BCL2-associated X protein (BAX) transcript variant sigma


  "NM_138764" in other vectors (5)

Reconstitution Protocol

USD 420.00

2 Weeks*

Size
    • 10 ug

Product Images

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol BAX
Synonyms BCL2L4
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_138764, the custom clone sequence may differ by one or more nucleotides
ATGGACGGGTCCGGGGAGCAGCCCAGAGGCGGGGGGCCCACCAGCTCTGAGCAGATCATG
AAGACAGGGGCCCTTTTGCTTCAGGGTTTCATCCAGGATCGAGCAGGGCGAATGGGGGGG
GAGGCACCCGAGCTGGCCCTGGACCCGGTGCCTCAGGATGCGTCCACCAAGAAGCTGAGC
GAGTGTCTCAAGCGCATCGGGGACGAACTGGACAGTAACATGGAGCTGCAGAGGATGATT
GCCGCCGTGGACACAGACTCCCCCCGAGAGGTCTTTTTCCGAGTGGCAGCTGACATGTTT
TCTGACGGCAACTTCAACTGGGGCCGGGTTGTCGCCCTTTTCTACTTTGCCAGCAAACTG
GTGCTCAAGGCCCTGTGCACCAAGGTGCCGGAACTGATCAGAACCATCATGGGCTGGACA
TTGGACTTCCTCCGGGAGCGGCTGTTGGGCTGGATCCAAGACCAGGGTGGTTGGACCGTG
ACCATCTTTGTGGCGGGAGTGCTCACCGCCTCACTCACCATCTGGAAGAAGATGGGC
Restriction Sites Please inquire     
ACCN NM_138764
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_138764.4, NP_620119.2
RefSeq Size 849 bp
RefSeq ORF 540 bp
Locus ID 581
Cytogenetics 19q13.33
Protein Families Druggable Genome, Transmembrane
Protein Pathways Amyotrophic lateral sclerosis (ALS), Apoptosis, Colorectal cancer, Huntington's disease, Neurotrophin signaling pathway, p53 signaling pathway, Pathways in cancer, Prion diseases
Gene Summary 'The protein encoded by this gene belongs to the BCL2 protein family. BCL2 family members form hetero- or homodimers and act as anti- or pro-apoptotic regulators that are involved in a wide variety of cellular activities. This protein forms a heterodimer with BCL2, and functions as an apoptotic activator. The association and the ratio of BAX to BCL2 also determines survival or death of a cell following an apoptotic stimulus. This protein is reported to interact with, and increase the opening of, the mitochondrial voltage-dependent anion channel (VDAC), which leads to the loss in membrane potential and the release of cytochrome c. The expression of this gene is regulated by the tumor suppressor P53 and has been shown to be involved in P53-mediated apoptosis. Multiple alternatively spliced transcript variants, which encode different isoforms, have been reported for this gene. [provided by RefSeq, Dec 2019]'
Transcript Variant: This variant (sigma) has an alternate splice site in the 3' coding region which causes a frame-shift, compared to variant 1. The resulting isoform (sigma) has a shorter and different C terminus, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.