PIGX (NM_017861) Human Untagged Clone

CAT#: SC327768

PIGX (untagged)-Human phosphatidylinositol glycan anchor biosynthesis class X (PIGX) transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PIGX
• Synonyms: PIG-X
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_017861, the custom clone sequence may differ by one or more nucleotides
  
  
  CTGGCGGCTCGGGTGGCGGCGGTTCGGGCGGCCGCCTGGCTGCTCCTCGGGGCGGCGACCGGGCTCACGC
  GCGGGCCCGCCGCGGCCTTCACCGCCGCGCGCTCTGACGCCGGCATAAGGGCCATGTGTTCTGAAATTAT
  TTTGAGGCAAGAAGTTTTGAAAGATGGTTTCCACAGAGACCTTTTAATCAAAGTGAAGTTTGGGGAAAGC
  ATTGAGGACTTGCACACCTGCCGTCTCTTAATTAAACAGGACATTCCTGCAGGACTTTATGTGGATCCGT
  ATGAGTTGGCTTCATTACGAGAGAGAAACATAACAGAGGCAGTGATGGTTTCAGAAAATTTTGATATAGA
  GGCCCCTAACTATTTGTCCAAGGAGTCTGAAGTTCTCATTTATGCCAGACGAGATTCACAGTGCATTGAC
  TGTTTTCAAGCCTTTTTGCCTGTGCACTGCCGCTATCATCGGCCGCACAGTGAAGATGGAGAAGCCTCGA
  TTGTGGTCAATAACCCAGATTTGTTGATGTTTTGTGACCAAGAGTTCCCGATTTTGAAATGCTGGGCTCA
  CTCAGAAGTGGCAGCCCCTTGTGCTTTGGAGAATGAGGATATCTGCCAATGGAACAAGATGAAGTATAAA
  TCAGTATATAAGAATGTGATTCTACAAGTTCCAGTGGGACTGACTGTACATACCTCTCTAGTATGTTCTG
  TGACTCTGCTCATTACAATCCTGTGCTCTACATTGATCCTTGTAGCAGTTTTCAAATATGGCCATTTTTC
  CCTATAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_017861
• ORF Size: 777 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_017861.3, NP_060331.3
• RefSeq Size: 3052
• RefSeq ORF: 777
• Locus ID: 54965
• Protein Families: Transmembrane
• Protein Pathways: Glycosylphosphatidylinositol(GPI)-anchor biosynthesis, Metabolic pathways
• Gene Summary: This gene encodes a type I transmembrane protein in the endoplasmic reticulum (ER). The protein is an essential component of glycosylphosphatidylinositol-mannosyltransferase I, which transfers the first of the four mannoses in the GPI-anchor precursors during GPI-anchor biosynthesis. Studies in rat indicate that the protein is translated from a non-AUG translation initiation site. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
  Transcript Variant: This variant (2) lacks an alternate in-frame exon in the central coding region, compared to variant 1, resulting in an isoform (2) that is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.