CHAC1 (NM_024111) Human Untagged Clone
CAT#: SC327770
CHAC1 (untagged)-Human ChaC cation transport regulator homolog 1 (E. coli) (CHAC1) transcript variant 1
"NM_024111" in other vectors (11)
Product Images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Symbol | CHAC1 |
| Synonyms | MGC4504 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>NCBI ORF sequence for NM_024111, the custom clone sequence may differ by one or more nucleotides
ATGGGGGGCGCTCAGCTGGAGCTACCGAGCGGTGCCAGGCCAGGTGTGTGCGTCCGTCGGTCTTTCCGTG CCCACGCCGGAGACCAGCCCCGGAGGCCGCCTGGGCCTATCCCTGTGCCAGGCACCATGAAGCAGGAGTC TGCAGCCCCGAACACCCCGCCCACCTCGCAGTCCCCTACGCCGTCCGCTCAGTTCCCCCGAAACGACGGC GACCCTCAAGCGCTGTGGATTTTCGGGTACGGCTCCCTGGTGTGGAGGCCCGACTTCGCCTACAGCGACA GCCGTGTGGGCTTCGTGCGCGGCTACAGCCGCCGTTTCTGGCAGGGAGACACCTTCCATCGGGGCAGCGA CAAGATGCCTGGCCGTGTGGTGACGCTCCTTGAAGATCATGAGGGCTGCACTTGGGGCGTGGCATACCAA GTGCAAGGGGAGCAGGTAAGCAAGGCCCTGAAGTACCTGAATGTGCGAGAGGCAGTGCTTGGTGGCTACG ATACCAAGGAGGTCACCTTCTATCCCCAAGATGCTCCTGACCAACCACTGAAGGCATTGGCCTATGTGGC CACCCCACAGAACCCTGGTTACCTGGGCCCTGCGCCTGAAGAGGCCATTGCCACGCAGATCCTGGCCTGC CGGGGCTTCTCCGGCCACAACCTTGAATACTTGCTGCGTCTGGCAGACTTCATGCAGCTCTGTGGGCCTC AGGCGCAGGACGAGCACCTGGCAGCCATCGTGGACGCTGTGGGCACCATGTTGCCCTGCTTCTGCCCCAC CGAGCAGGCTCTGGCGCTGGTGTGA |
| Restriction Sites | Please inquire |
| ACCN | NM_024111 |
| ORF Size | 1578 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Reference Data | |
| RefSeq | NM_024111.3, NP_077016.2 |
| RefSeq Size | 1578 |
| RefSeq ORF | 1578 |
| Locus ID | 79094 |
| Domains | ChaC |
| Gene Summary | This gene encodes a member of the gamma-glutamylcyclotransferase family of proteins. The encoded protein has been shown to promote neuronal differentiation by deglycination of the Notch receptor, which prevents receptor maturation and inhibits Notch signaling. This protein may also play a role in the unfolded protein response, and in regulation of glutathione levels and oxidative balance in the cell. Elevated expression of this gene may indicate increased risk of cancer recurrence among breast and ovarian cancer patients. [provided by RefSeq, Sep 2016] Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (a). |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| SC111411 | CHAC1 (untagged)-Human ChaC, cation transport regulator homolog 1 (E. coli) (CHAC1), transcript variant 1 |
USD 420.00 |
|
| RC200912 | CHAC1 (Myc-DDK-tagged)-Human ChaC, cation transport regulator homolog 1 (E. coli) (CHAC1), transcript variant 1 |
USD 450.00 |
|
| RC229135 | CHAC1 (Myc-DDK-tagged)-Human ChaC, cation transport regulator homolog 1 (E. coli) (CHAC1), transcript variant 1 |
USD 450.00 |
|
| RG200912 | CHAC1 (GFP-tagged) - Human ChaC, cation transport regulator homolog 1 (E. coli) (CHAC1), transcript variant 1 |
USD 460.00 |
|
| RG229135 | CHAC1 (GFP-tagged) - Human ChaC, cation transport regulator homolog 1 (E. coli) (CHAC1), transcript variant 1 |
USD 570.00 |
|
| RC200912L1 | Lenti ORF clone of Human ChaC, cation transport regulator homolog 1 (E. coli) (CHAC1), transcript variant 1, Myc-DDK-tagged |
USD 750.00 |
|
| RC200912L2 | Lenti ORF clone of Human ChaC, cation transport regulator homolog 1 (E. coli) (CHAC1), transcript variant 1, mGFP tagged |
USD 750.00 |
|
| RC200912L3 | Lenti ORF clone of Human ChaC, cation transport regulator homolog 1 (E. coli) (CHAC1), transcript variant 1, Myc-DDK-tagged |
USD 750.00 |
|
| RC200912L4 | Lenti ORF clone of Human ChaC, cation transport regulator homolog 1 (E. coli) (CHAC1), transcript variant 1, mGFP tagged |
USD 750.00 |
|
| RC229135L1 | Lenti ORF clone of Human ChaC, cation transport regulator homolog 1 (E. coli) (CHAC1), transcript variant 1, Myc-DDK-tagged |
USD 888.00 |
|
| RC229135L3 | Lenti ORF clone of Human ChaC, cation transport regulator homolog 1 (E. coli) (CHAC1), transcript variant 1, Myc-DDK-tagged |
USD 720.00 |
{0} Product Review(s)
Be the first one to submit a review
Germany
Japan
United Kingdom
China