PCMT1 (NM_005389) Human Untagged Clone

CAT#: SC327775

PCMT1 (untagged)-Human protein-L-isoaspartate (D-aspartate) O-methyltransferase (PCMT1)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PCMT1
• Synonyms: PIMT
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_005389, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCCGGGAGCGCGCAGTGGCGGCAGCGGCGGCGACGGCAGTAACAGCGGCAGCTACAGCGGGGACGCGA
  GCGGGGCGGTGACGGTGTGGGAGGTGGTCTCACTCTTGGGAAAACTGCTGGGCACCGTCGTCGCGCTGAA
  GGTGGTTCTGTACCTGCTCCGAGTGTGCTTAGCGATGGCCTGGAAATCCGGCGGCGCCAGCCACTCGGAG
  CTAATCCACAATCTCCGCAAAAATGGAATCATCAAGACAGATAAAGTATTTGAAGTGATGCTGGCTACAG
  ACCGCTCCCACTATGCAAAATGTAACCCATACATGGATTCTCCACAATCAATAGGTTTCCAAGCAACAAT
  CAGTGCTCCACACATGCATGCATATGCGCTAGAACTTCTATTTGATCAGTTGCATGAAGGAGCTAAAGCT
  CTTGATGTAGGATCTGGAAGTGGAATCCTTACTGCATGTTTTGCACGTATGGTTGGATGTACTGGAAAAG
  TCATAGGAATTGATCACATTAAAGAGCTAGTAGATGACTCAGTAAATAATGTCAGGAAGGACGATCCAAC
  ACTTCTGTCTTCAGGGAGAGTACAGCTTGTTGTGGGGGATGGAAGAATGGGATATGCTGAAGAAGCCCCT
  TATGATGCCATTCATGTGGGAGCTGCAGCCCCTGTTGTACCCCAGGCGCTAATAGATCAGTTAAAGCCCG
  GAGGAAGATTGATATTGCCTGTTGGTCCTGCAGGCGGAAACCAAATGTTGGAGCAGTATGACAAGCTACA
  AGATGGCAGCATCAAAATGAAGCCTCTGATGGGGGTGATATACGTGCCTTTAACAGATAAAGAAAAGCAG
  TGGTCCAGGTGGAAGTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_005389
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_005389.2, NP_005380.2
• RefSeq Size: 1751 bp
• RefSeq ORF: 858 bp
• Locus ID: 5110
• Cytogenetics: 6q25.1
• Domains: PCMT
• Protein Families: Druggable Genome
• Gene Summary: 'This gene encodes a member of the type II class of protein carboxyl methyltransferase enzymes. The encoded enzyme plays a role in protein repair by recognizing and converting D-aspartyl and L-isoaspartyl residues resulting from spontaneous deamidation back to the normal L-aspartyl form. The encoded protein may play a protective role in the pathogenesis of Alzheimer's disease, and single nucleotide polymorphisms in this gene have been associated with spina bifida and premature ovarian failure. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2011]'
  Transcript Variant: This variant (1) represents the longest transcript. Variants 1 and 6 encode the same isoform (1).