PYCR3 (NM_023078) Human Untagged Clone

CAT#: SC327776

PYCRL (untagged)-Human pyrroline-5-carboxylate reductase-like (PYCRL)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PYCR3
• Synonyms: PYCRL
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_023078, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGGCGGTGAGCGCAGCGGCGTCCGAGGCAACAAGATGGCAGCTGCGGAGCCGTCTCCGCGGCGCGTGG
  GCTTCGTGGGCGCGGGCCGCATGGCGGGGGCCATCGCGCAGGGCCTCATCAGAGCAGGAAAAGTGGAAGC
  TCAGCACATACTGGCCAGTGCACCAACAGACAGGAACCTATGTCACTTTCAAGCTCTGGGTTGCCGGACC
  ACGCACTCCAACCAGGAGGTGCTGCAGAGCTGCCTGCTCGTCATCTTTGCCACCAAGCCTCATGTGCTGC
  CAGCTGTCCTGGCAGAGGTGGCTCCTGTGGTCACCACTGAACACATCTTGGTGTCCGTGGCTGCTGGGGT
  GTCTCTGAGCACCCTGGAGGAGCTGCTGCCCCCAAACACACGGGTGCTGCGGGTCTTGCCCAACCTGCCC
  TGTGTGGTCCAGGAAGGGGCCATAGTGATGGCGCGGGGCCGCCACGTGGGGAGCAGCGAGACCAAGCTCC
  TGCAGCATCTGCTGGAGGCCTGTGGGCGGTGTGAGGAGGTGCCTGAAGCCTACGTCGACATCCACACTGG
  CCTCAGTGGCAGTGGCGTGGCCTTCGTGTGTGCATTCTCCGAGGCCCTGGCTGAAGGAGCCGTCAAGATG
  GGCATGCCCAGCAGCCTGGCCCACCGCATCGCTGCCCAGACCCTGCTGGGGACGGCCAAGATGCTGCTGC
  ACGAGGGCCAACACCCAGCCCAGCTGCGCTCAGACGTGTGCACCCCGGGTGGCACCACCATCTATGGACT
  CCACGCCCTGGAGCAGGGCGGGCTGCGAGCAGCCACCATGAGCGCCGTGGAGGCTGCCACCTGCCGGGCC
  AAGGAGCTCAGCAGAAAGTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_023078
• ORF Size: 861 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_023078.3, NP_075566.2
• RefSeq Size: 2678
• RefSeq ORF: 861
• Locus ID: 65263
• Domains: P5CR
• Protein Pathways: Arginine and proline metabolism, Metabolic pathways
• Gene Summary: This gene encodes a protein that belongs to the pyrroline-5-carboxylate reductase family of enzymes. Members of this family catalyze the final step in proline biosynthesis, converting pyrroline-5-carboxylate to proline. Glutamate and ornithine are precursors in the synthesis of proline. The protein encoded by this gene is a cytoplasmic enzyme involved in the biosynthesis of proline from ornithine. [provided by RefSeq, Aug 2016]
  Transcript Variant: This variant (1) encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. CCDS Note: The coding region has been updated to shorten the N-terminus to one that is more supported by conservation.