DNAJB12 (NM_001002762) Human Untagged Clone

CAT#: SC327834

DNAJB12 (untagged)-Human DnaJ (Hsp40) homolog subfamily B member 12 (DNAJB12) transcript variant 1


  "NM_001002762" in other vectors (5)

Reconstitution Protocol

USD 700.00

5 Weeks*

Size
    • 10 ug

Product Images

Other products for "DNAJB12"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol DNAJB12
Synonyms DJ10
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_001002762, the custom clone sequence may differ by one or more nucleotides
ATGTCATCACTCCGCGCCCGGCTGCCCGCGACGCGCCGGCGGGTGGCGCAGCCCTTCGCT
CGCCCGGCCTCCCCCTCCCTGGTTCCGCGTTCTGGTTCCGCCATGGAATCCAACAAGGAT
GAAGCTGAGCGCTGTATCAGCATCGCCCTCAAGGCCATCCAGAGCAACCAGCCCGACCGG
GCGCTCCGCTTCCTGGAGAAGGCACAGCGGCTGTATCCGACGCCGCGAGTTCGCGCCCTG
ATTGAGTCCCTCAACCAGAAACCACAGACTGCCGGTGACCAACCCCCACCCACAGACACA
ACCCATGCCACCCACAGGAAAGCAGGTGGGACCGATGCCCCCTCGGCCAACGGTGAAGCT
GGAGGAGAGAGCACCAAAGGCTACACTGCAGAACAGGTTGCAGCTGTGAAAAGGGTCAAG
CAATGTAAAGATTACTATGAGATCCTGGGGGTGAGCAGAGGGGCCTCGGATGAGGACCTG
AAGAAGGCCTACCGCAGACTGGCCCTCAAATTCCACCCAGACAAGAACCACGCACCTGGT
GCCACTGAAGCCTTCAAAGCCATTGGCACAGCATATGCGGTACTCAGCAACCCGGAGAAG
AGGAAGCAGTATGACCAGTTCGGCGATGACAAGAGCCAGGCGGCCCGGCACGGCCATGGG
CATGGGGATTTCCACCGTGGCTTTGAGGCCGACATCTCCCCTGAAGACCTCTTCAACATG
TTCTTTGGCGGCGGCTTCCCTTCTAGTAACGTCCACGTCTACAGCAACGGCCGCATGCGC
TATACCTACCAGCAAAGGCAGGACCGCAGGGACAACCAGGGTGATGGCGGGCTAGGGGTG
TTTGTGCAGCTGATGCCTATCCTCATCCTGATTCTCGTGTCAGCTCTCAGCCAGCTCATG
GTCTCCAGTCCACCCTACAGTCTGAGTCCAAGACCGTCCGTGGGCCACATCCACAGGCGA
GTCACTGACCACCTGGGTGTCGTCTACTATGTGGGAGACACTTTCTCCGAAGAGTACACA
GGCTCCAGCCTCAAAACAGTCGAGCGGAATGTGGAAGATGATTATATCGCCAACCTCCGG
AACAACTGCTGGAAGGAGAAGCAGCAGAAGGAAGGCTTGCTGTACCGGGCACGCTACTTT
GGCGACACAGATATGTACCACAGAGCACAGAAGATGGGCACCCCCAGCTGCAGCCGACTG
TCAGAGGTGCAGGCCTCCCTGCATGGA
Restriction Sites Please inquire     
ACCN NM_001002762
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001002762.2, NP_001002762.2
RefSeq Size 4377 bp
RefSeq ORF 1230 bp
Locus ID 54788
Cytogenetics 10q22.1
Protein Families Transmembrane
Gene Summary DNAJB12 belongs to the evolutionarily conserved DNAJ/HSP40 family of proteins, which regulate molecular chaperone activity by stimulating ATPase activity. DNAJ proteins may have up to 3 distinct domains: a conserved 70-amino acid J domain, usually at the N terminus; a glycine/phenylalanine (G/F)-rich region; and a cysteine-rich domain containing 4 motifs resembling a zinc finger domain (Ohtsuka and Hata, 2000 [PubMed 11147971]). [supplied by OMIM, Mar 2008]
Transcript Variant: This variant (1) represents the longer transcript. Variants 1, 2 and 4 encode the same protein. CCDS Note: The coding region has been updated to shorten the N-terminus to one that is more supported by conservation.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.